1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
3 years ago
7

What is transport sugar

Biology
1 answer:
Lilit [14]3 years ago
8 0

Answer:

Summary Sugar Transport. Sugars, which are formed by the plant during photosynthesis, are an essential component of plant nutrition. Like water, sugar (usually in the form of sucrose, though glucose is the original photosynthetic product) is carried throughout the parts of the plant by the vascular system.

Explanation:

You might be interested in
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
What happens to the particles when you put a metal spoon into a pot of boiling water.
lana [24]
Physics understands heat as the energy that is transferred from one system to another or from one body to another; a transfer linked to the movement of molecules, atoms and other particles. Heat is a source of energy, and as such, it needs a medium in which to transmit
7 0
3 years ago
The process of scientific inquiry can be best used to answer which question? Why do diseases exist? What should I do? Why do bad
dmitriy555 [2]
I don't know about the other ones but the sky is blue because molecules move from the sun than the red from the sun. The blue has separated from the sun.
7 0
4 years ago
Which unmanned craft is used to collect data about bodies in space?
viktelen [127]

Answer:

Space probe

Explanation:

Probes send data back to earth for scientists to study. Sputnik 1 was tbe first probe to go into soace

5 0
3 years ago
Read 2 more answers
Definition: this is one explanation of enzyme specificity that states an enzyme and its substrate possess specific complementary
wolverine [178]
It is called lock and key model. it theorize that enzymes and its substrate behave like a lock and key which fits into each other and does not fit into any other system(lock or key)
3 0
3 years ago
Other questions:
  • Which statement best describes a benefit of conducting a comparative investigation over collecting data from the Internet?
    14·1 answer
  • How are seeds and photosynthesis related
    9·2 answers
  • What is the role of RNA within the cell
    11·1 answer
  • Simulated environment with equal amounts of insects seeds and fruit which flock will be able to eat the most the least and why
    13·1 answer
  • In some developing nations, the percentage of animal protein from fish in the diet can be as high as____. 20 percent 80 percent
    9·1 answer
  • The resultant of two vectors acting at a 90°-angle can be determined from the ___ of the rectangle.
    12·2 answers
  • Eukaryotic cells undergo mitosis, which produces two identical daughter cells. These cells are identical to each other and to th
    12·2 answers
  • Que son las lesiones musculares?
    8·1 answer
  • According to the Punnett square, offspring from these two parents have a ____________ chance of inheriting one B allele and one
    7·1 answer
  • Describe the roles of the national and state governments in the amendment process?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!