1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ahat [919]
3 years ago
8

Which type of environmental scientist is most likely to study how whales are affected by pollution

Biology
2 answers:
bezimeni [28]3 years ago
6 0
D) Oceanographer
Oceanographer are the scientists how study the life in water
ki77a [65]3 years ago
4 0
Oceanography bc they study on the ocean and whats going on
You might be interested in
Two pure lines of four-o'clock plants, one with red flowers and the other with white flowers, are crossed. The F1 progeny all ar
Lubov Fominskaja [6]

Answer:

<h2>Incomplete dominance</h2>

Explanation:

As given here;

Two pure line of four-o'clock plant, one having red flower and other having white flower, when they are crossed, they produce all pink progeny.

So, lets red as RR and white as rr

Cross between RR and rr

Here all offspring are Rr ( Pink ).

It's the result of incomplete dominance, in complete dominance the offspring is the intermediate of both the parents.

F2 generation:

As cross between Rr and Rr

progeny are: RR, Rr, Rr, rr

RR =red

Rr= pink

rr= white

So,  red: pink: white = 25:50:25

3 0
3 years ago
How did this fossil form?
muminat

Answer:

C.   It was covered in sediment.

Explanation:

6 0
3 years ago
Read 2 more answers
Which action would most likely increase the greenhouse effect?
Vikentia [17]
B because the burning of fossil fuels release greenhouse gasses
6 0
3 years ago
Read 2 more answers
"what would happen to a cell if it did not contain any lysosomes (or if its lysosomes were not functioning)? would the cell be a
nataly862011 [7]
Without lysosomes, the cell would not be able to break down no longer functioning cellular components, other wastes, or foreign invaders. The buildup of those wastes would kill the cell, as would a pathogen that cannot be killed by that cell.
8 0
3 years ago
(short writing) Phototropism is a phenomenon observed in plants. Phototropism is best described as a plant’s response to light.
11Alexandr11 [23.1K]

1) a) Auxin moves to the darker side of the plant, causing the cells there to grow larger than corresponding cells on the lighter side of the plant. This produces a curving of the plant stem tip toward the light, a plant movement known as phototropism. Auxin also plays a role in maintaining apical dominance.

7 0
3 years ago
Other questions:
  • Distinguish between diffusion and equilibrium
    6·1 answer
  • Match the recommended carbohydrate intake for the conditions listed (answer may be used more than once). Intake one hour prior t
    10·1 answer
  • What is an "asterism?"
    9·1 answer
  • Your environment consists of all the living and nonliving things that surround and support you. true false
    12·1 answer
  • Approximately how long do scientists think chemical evolution took?
    6·1 answer
  • What causes wind?
    7·2 answers
  • 6. Calculate the kinetic energy of a baseball thrown by Aroldis Chapman, who holds the world record for fastest pitch. The baseb
    6·1 answer
  • In some pea plant crosses, the plants are self-pollinated. Is self-pollination considered asexual or sexual reproduction? Explai
    10·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • If cells don't work together, what would happen to the organism? ​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!