1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
14

How is adp converted to atp?

Biology
1 answer:
Georgia [21]3 years ago
7 0
<span> ADP and ATP move pretty much in a cycle.  ADP is converted to ATP by the weak bond formed between the ADP molecule and a third phosphate group.  ATP moves to ADP by the removal of that weakly bonded phosphate group.  </span>

You might be interested in
What can you infer about the role of parental care for the three species represented in the graph
olya-2409 [2.1K]

Parental care has been demonstrated to provide offspring greater chances of survival by protecting them from predators and teaching them survival skills.

<h3>What is the role of parental care in offspring?</h3>

Parental care refers to the care and attention provided by parents to their offspring when they are born.

Parental care is beneficial to offspring as it increases their chances of survival.

Only higher animals like birds and mammals provide parental care to their offspring and this increases the chances of the offspring to survive.

Therefore, parental care has been demonstrated to provide offspring greater chances of survival.

Learn more about parental care at: brainly.com/question/9002548

#SPJ1

4 0
2 years ago
During elongation, a charged trna first enters the ribosomal ________ site and then moves into the ________ site.
anygoal [31]
3 sites in a ribosome:

The charged tRNA first enters the ribosomal A site...then moves to the P site and finally to the E site.

Because they only ask for 2 I would say A then P.
5 0
4 years ago
PRUEBA DE QUÍMICA
vampirchik [111]

Answer:  Creo que es B

Explanation:

P.S(eso fue muy difícil. Lo siento mucho si se equivoca.)

5 0
3 years ago
Convert the distance from Kilometers to miles
Varvara68 [4.7K]
Kuniper belt is equal distance to 4.039•10^9.

alpha centauri is equal distance to 2.734•10^13.
8 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Other questions:
  • Of the following statements, select all (2) that are true.
    11·1 answer
  • How does the spinal cord work with other systems to keep the body healthy? Give at least 3 examples
    12·1 answer
  • Which is the SI base unit of mass? meter liter pound kilogram
    14·2 answers
  • Which is one purpose of cell division?
    15·2 answers
  • In one type of plant, orange petals (O) are dominant over yellow petals (o) and tall stems (T) are dominant over short stems (t)
    5·1 answer
  • Stoplights have a taste that is preferred by gobblers. Suppose a mutation occurred in the gene for taste. The mutation resulted
    5·1 answer
  • List the functions of proteins in the text area below.
    10·2 answers
  • How are models related to theories and hypothesis ?
    7·1 answer
  • What does the pulmonary vein do?
    9·2 answers
  • Which one is the true answer
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!