1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PSYCHO15rus [73]
3 years ago
9

A heat engine converts thermal energy into what?

Biology
1 answer:
horrorfan [7]3 years ago
5 0

Answer:

i is either chemical energy or electrical energy im mostly going to chemical energy but im not sure

Explanation:

You might be interested in
The unpaired cartilage of the larynx that is made of elastic cartilage and bends when you swallow is called the
trasher [3.6K]
Epiglottis

The epiglotis is what allows you to swallow food without inhaling it.  It acts as a gateway between the digestive and respiratory systems
5 0
3 years ago
How do you the four nucleotides in RNA always pair up?​
eduard
Adenine pairs with uracil
guanine pairs with cytosine
8 0
3 years ago
Neurons conduct and receive information from other neurons in the form of electrical currents. the receiving end of the neuron i
777dan777 [17]
Dendrite; axon; synapse

These are parts of the neuron which is considered as the basic unit of nervous system. The cell responsible for receiving sensory input from the external environment. The stimulus will be transported in an electrical signal via neuronal parts. Axon transmit signal to the other neuron. Dendrites are the receiving part of the neuron. Synapse is the space between each neuron where elctrical impulse is converted into a chemical signal via neurotransmitters.

8 0
4 years ago
After transcription, the new mRNA strand travels to the cytoplasm and over to the ___________ where the genetic code will be tra
Anastaziya [24]
The answer is C ribosomes
3 0
3 years ago
A key point in Darwin’s explanation of evolution is that Group of answer choices1. the biological structures most likely inherit
zaharov [31]

3. any trait that confers even a small increase in the probability that its possessor will survive and reproduce will be strongly favored and will spread through the population.

Explanation:

  • Natural selection is a nonrandom process by which biological traits become more or less common in a population as a function of the differential reproduction of their bearers of differences in the rate of survival.
  • Natural selection can act on any heritable phenotypic trait and operate among any entities that reproduce, show inheritance of their characteristics from one generation to the next, and vary in fitness.
  • Natural selection is the machine that drives evolution. It also explains adaptation.
8 0
3 years ago
Other questions:
  • Which of the following produces the first heart sound?
    10·2 answers
  • The combanation of a________ and an _____ produces a zygote with 46 chromosomes
    7·1 answer
  • Select all that apply.
    9·2 answers
  • Which of the following is a value of biodiversity?
    14·2 answers
  • Where do most photosynthesis take place
    5·1 answer
  • Cherrapunji,
    14·1 answer
  • The manufacturer of the chocolate mint cookies changed the ingredients of its cookies. Each serving now has 1 gram of saturated
    14·1 answer
  • Tell some thing about Ch 9 of class 8th ​
    11·1 answer
  • the results Mendel obtained during his experiments. It showed that if you cross two plants that were true-breeding for different
    7·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!