The antibiotic called ampicillin was not effective against E.coli.
Answer: D
Explanation:
E.coli is normal microbial flora which is present in the gut of the mammals.
It is gram negative bacteria and very few strains of this bacteria causes harm.
Antibiotics are the chemical drugs which are used to treat the microbial infection either by killing the causative organism or by its growth inhibition.
Antibiotics such as neomycin, penicillin and erythromycin are usually used to treat E.coli infection.
Antibiotic such as Ampicillin is not used as the bacterium E.coli is highly resistant to it.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Options:
A. horse
B. bacterium
C. oak tree
D. starfish
The answer is ''starfish" or option D. Mitosis is cell division that includes two daughter cells that actually has the same amount of chromosomes as each other. (most likely twins) Mitosis is also part of the cell cycle with meiosis which helps the organism remain homeostasis and homeostasis is the process organism used to stay cold on a arm day, or stay warm on a cold day.
Hope this helps!
<em>~Nonportrit </em>