All categories

3 years ago

What is one element a topographic map shows? 1.Elevation 2.Space 3.Temperature 4.Weather

Biology

2 answers:

m_a_m_a [10]3 years ago

4 0

Elevation (it uses different colors to show the elevation of different places such as plains and mountains)

il63 [147K]3 years ago

3 0

Answer:

Option (1)

Explanation:

The maps are the 2 dimensional representation of the earth. The topographic maps are defined as those maps that highlights the type of area, its relief, structures and features that are present on the earth's surface. These maps are made using a scale known as the map scale. These maps are helpful because it provides the essential data regarding a particular area.

In a topographic map, the elevations are conveniently shown using lines and each line represents the height from the mean sea level. These lines are separated from one another by a fixed vertical distance and are known as the contour intervals.

Thus, the correct answer is option (1).

You might be interested in

The diagram below shows the change in plant species during ecological sucession, beginning with the pioneer species. What types

ASHA 777 [7]

Fish and turtles and snakes

6 0

3 years ago

Which antibiotic was not effective against E. coli? neomycin, penicillin, erythromycin, ampicillin

qaws [65]

The antibiotic called ampicillin was not effective against E.coli.

Answer: D

Explanation:

E.coli is normal microbial flora which is present in the gut of the mammals.

It is gram negative bacteria and very few strains of this bacteria causes harm.

Antibiotics are the chemical drugs which are used to treat the microbial infection either by killing the causative organism or by its growth inhibition.

Antibiotics such as neomycin, penicillin and erythromycin are usually used to treat E.coli infection.

Antibiotic such as Ampicillin is not used as the bacterium E.coli is highly resistant to it.

6 0

3 years ago

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

3 years ago

What structural feature of cells can allow molecules to flow directly from the inside of one Plant cell to the inside of another

nirvana33 [79]

Cell membrane I think ?

8 0

3 years ago

Which organism is capable of reproduction through asexual mitosis?

Sunny_sXe [5.5K]

Options:

A. horse

B. bacterium

C. oak tree

D. starfish

The answer is ''starfish" or option D. Mitosis is cell division that includes two daughter cells that actually has the same amount of chromosomes as each other. (most likely twins) Mitosis is also part of the cell cycle with meiosis which helps the organism remain homeostasis and homeostasis is the process organism used to stay cold on a arm day, or stay warm on a cold day.

Hope this helps!

<em>~Nonportrit </em>

7 0

3 years ago