1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tino4ka555 [31]
3 years ago
7

1. What is the limiting factor for most animal life in the open ocean?

Biology
1 answer:
Oduvanchick [21]3 years ago
6 0

Answer:

plastic pollution

Explanation:

Donald trump

and America well the ones that like him

You might be interested in
Angiosperms do not need water for fertilization. Why? (3 points) Group of answer choices Flagellated sperm travel to the ovary i
astraxan [27]

Answer:

A pollen tube grows from the pollen grain into the ovary

Explanation:

Water is needed for fertilization in several plant groups because the sperm needs to swim to meet the non-motile eggs of the female organs.

<em>However in angiosperms, the pollen germinates and a structure known as pollen tube which contains the male gametophyte (sperm) grows into the ovary where the ovule is located and the male gametophyte is deposited in the ovule to initiate the fertilization process.</em>

<em>Hence, water is really not necessary for fertilization in the angiosperms.</em>

5 0
3 years ago
Read 2 more answers
What is the difference between a mechanical layer and a compositional layer?
xenn [34]
Compositional layers are determined by their components, while mechanical layers are determined by their physical properties.
5 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Can someone please answer my last question its in biology and 7th grade
Sloan [31]

Answer:

yes please

Explanation:

what's the question

4 0
3 years ago
2+2=???? idkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidk
Tasya [4]

Answer:

4

Explanation:

2+2=4. It is a very complex equation. Hope this helps!

-Aslina

7 0
4 years ago
Other questions:
  • I need help with questions please
    10·1 answer
  • Which of the following statements about the cytoskeleton is incorrect? A. The dynamic aspect of cytoskeletal function is made po
    7·1 answer
  • Does anyone know what "D" is pointing to and what it's called?pic shown
    9·2 answers
  • What is the origin of each strand of the new double helices created after DNA replication?
    7·1 answer
  • Help Please ~ 20 points
    5·2 answers
  • In pulsus paradoxus, even if the pulse cannot be palpated, it can still be heard by using a BP cuff and stethoscope.
    5·1 answer
  • Ricky observed this organism under the microscope.
    5·1 answer
  • Giving brainliest , only number one pls
    10·2 answers
  • In which direction and why will osmosis occur if a 15% sugar solution is separated from a 25% sugar solution by a selectively pe
    13·2 answers
  • In what direction will osmosis occur if a 35% sugar solution is separated from a 15% sugar solution by a selectively permeable m
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!