1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
14

PLS HELP ME WITH THIS!!! What is the nucleotide sequence of the mRNA strand you built?

Biology
2 answers:
Shalnov [3]3 years ago
8 0

Answer:

AUG CUG ACC UAG

Explanation

If this question is on the gizmo "RNA and Protein Synthesis" then this is the answer for that.

Ad libitum [116K]3 years ago
5 0

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

You might be interested in
Directions: Select each correct answer. More than one answer may be correct. It has been theorized that all of the modern contin
Firdavs [7]

the answer to this question is all of these (a,b,c)

3 0
3 years ago
Read 2 more answers
How are convection current in the mantle and in the oceans similar? How are they different?
Vanyuwa [196]

Hello,


Convection currents in the mantle and in the ocean are similar because they both are responsible for the shaping the Earth's surface. Two forces are behind the movement of Earth's huge land masses. Those forces are convection and gravity.


Convection describes the movement of gasses or liquids due to different temperatures. The convection currents just beneath Earth's crust flow very slowly, causing movement in the plates above them. These currents are different with the fact that they produce different plate movements. Ridge push occurs from the convection currents in the ocean. These occur at mid-ocean ridges, which are elevated higher than the rest of the ocean floor. In contrary, convection causes material in the mantle to flow. Due to combined action of convection currents and gravity, Earth's plates are in constant motion.



Faith xoxo


8 0
3 years ago
How does a virus differ from a common cell?Immersive Reader It has no nucleus, cell wall, or organelles. It has two nuclei and n
melamori03 [73]
A bc FGF bf d no if Harry
3 0
3 years ago
Read 2 more answers
Suppose 10,000 units of energy are available at the level of the grasses. What is the total number of energy units available by
jok3333 [9.3K]

Answer:

90 units........................

5 0
2 years ago
I WILL GIVE BRAINLIEST​
Oduvanchick [21]
Carbon dioxide can be transported through the blood via three methods. It is dissolved directly in the blood, bound to plasma proteins or hemoglobin, or converted into bicarbonate.

The majority of carbon dioxide is transported as part of the bicarbonate system. Carbon dioxide diffuses into red blood cells. Inside, carbonic anhydrase converts carbon dioxide into carbonic acid (H2CO3), which is subsequently hydrolyzed into bicarbonate (HCO3−) and H+. The H+ ion binds to hemoglobin in red blood cells, and bicarbonate is transported out of the red blood cells in exchange for a chloride ion. This is called the chloride shift.

Bicarbonate leaves the red blood cells and enters the blood plasma. In the lungs, bicarbonate is transported back into the red blood cells in exchange for chloride. The H+ dissociates from hemoglobin and combines with bicarbonate to form carbonic acid with the help of carbonic anhydrase, which further catalyzes the reaction to convert carbonic acid back into carbon dioxide and water. The carbon dioxide is then expelled from the lungs.
6 0
3 years ago
Other questions:
  • If a plant has a mutation and cannot produce Casparian strips, what process won't it be able to do?
    13·2 answers
  • If rats are allowed to wander through a complicated maze, they will subsequently run the maze with few errors when a food reward
    7·1 answer
  • Besides Antarctica which continent is made up almost entirely of desert
    14·1 answer
  • The area of the lower limb that refers to the posterior side of the knee is the __________ region.
    11·1 answer
  • A textile company has started a program to recycle textiles so they are not added to a nearby landfill as part of the waste stre
    12·1 answer
  • Only gay answer this question <br>why men attract to each other​
    15·1 answer
  • The findings from cross-cultural research on the rates of births to unmarried mothers in 10 industrialized nations indicate that
    7·1 answer
  • Most of the dissolved substance in sea water is:
    14·1 answer
  • Which of the following is composed of more than two hundred billion stars, including the sun? (1 point)
    8·1 answer
  • Which amino acid might be expected to have the least effect on the function of an enzyme if it replaces a glu residue in the enz
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!