1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
14

PLS HELP ME WITH THIS!!! What is the nucleotide sequence of the mRNA strand you built?

Biology
2 answers:
Shalnov [3]3 years ago
8 0

Answer:

AUG CUG ACC UAG

Explanation

If this question is on the gizmo "RNA and Protein Synthesis" then this is the answer for that.

Ad libitum [116K]3 years ago
5 0

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

You might be interested in
Los árboles de manzano de zonas templadas no florecen naturalmente en el trópico. Un agrónomo hizo el siguiente experimento para
liberstina [14]

Answer:

ingles por favor

Explanation:

6 0
2 years ago
Read 2 more answers
How does a light moths variation in color change its probability of surviving in a dark - tree environment over time?
Pani-rosa [81]

Answer:

Due to the moths light color it won't be able to blend in with the darkly colored trees therefore being easily seen by predators.

8 0
3 years ago
After clara learned that penguins are birds that cannot fly, she had to modify her existing concept of birds. this best illustra
OLEGan [10]
Answer:  "accommodation".
________________________________
8 0
2 years ago
Read 2 more answers
List three structures of nerve cells that are found in animal cells.<br><br> (Science)
Over [174]

Answer:

 its cell body, dendrites, and axon

8 0
3 years ago
Is it possible to move in a curved path in the absence of a force?
Lilit [14]
Yes It's Possible for a curved path to move by force 
8 0
3 years ago
Other questions:
  • Explain what Darwin Thought about different animals with similar characteristics living in similar habitats around the world?
    7·1 answer
  • Where would the enzyme topoisomerase attach during dna replication?
    10·2 answers
  • A population of short-finned fish and a population of long-finned fish live in a lake. Fish with long fins swim faster than fish
    10·2 answers
  • Give an example of human cells that use active transport.
    7·1 answer
  • How do Venus flytrap obtain <br> homeostasis
    8·1 answer
  • Plant spores are usually
    12·1 answer
  • What is the function of DNA and where is it found in a eukaryote cell
    6·1 answer
  • Explain how carbon-12 and carbon-14 are different from each other ?
    11·2 answers
  • If a DNA strand has 32 % guanine, what percent thymine does it contain?
    10·1 answer
  • A person has two genes, A and B that are on the same chromosome and 25cM apart, what percentage of their gametes would you expec
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!