1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
14

PLS HELP ME WITH THIS!!! What is the nucleotide sequence of the mRNA strand you built?

Biology
2 answers:
Shalnov [3]3 years ago
8 0

Answer:

AUG CUG ACC UAG

Explanation

If this question is on the gizmo "RNA and Protein Synthesis" then this is the answer for that.

Ad libitum [116K]3 years ago
5 0

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

You might be interested in
After watching the video, how would you define the term ecological relationship? Are they always beneficial to organisms involve
dangina [55]

Answer:

There is no video but ecological relationship will be defined on a general note and it is not always beneficial to organisms.

Explanation:

In an ecosystem, organisms of the same or different species tend to interact with one another. This interaction is referred to as ECOLOGICAL RELATIONSHIP between the involved organisms. An ecological relationship can be of different types depending on the effect.

SYMBIOSIS is an ecological relationship between two organisms that interact together. SYMBIOSIS can either be mutualistic (both organisms benefit), parasitic (one organism loses and one gains), or commensalistic (one organism benefits and one neither benefits or loses). Another ecological relationship is PREDATION, where one organism called the PREDATOR feeds on part or all of another organism called PREY in order to obtain energy.

As stated above, some of the organisms involved in an ecological relationship benefits while others lose. Hence, it is not always a beneficial relationship to organisms.

7 0
3 years ago
Darwin’s theory of evolution is based on
Marizza181 [45]

Answer:

Darwinism is a theory of biological evolution developed by the English naturalist Charles Darwin (1809–1882) and others, stating that all species of organisms arise and develop through the natural selection of small, inherited variations that increase the individual's ability to compete, survive, and reproduce.

Explanation:

3 0
3 years ago
This is an excerpt from "When We Two Parted" by Lord Byron.
Diano4ka-milaya [45]
The main theme of the poem is the regret and sorrow the narrator feels about the end of his relationship with the woman in the poem, described only as "you." The poem suggests that the woman may well have been the one to break off the affair: Pale grew thy cheek and col
4 0
3 years ago
After watching a show about submarines, Jamil wants to learn more about the oceans. Which question could be answered through sci
faust18 [17]
Answer: What substances dissolve in ocean water.
This is the only question that can be answered through scientific investigation because it is the only question that can be tested. The other questions cannot be answered through scientific investigation because they based on opinions which are more abstract.
5 0
3 years ago
Read 2 more answers
What is a transformer?!?!
Vladimir79 [104]
The transformer is a static electric machine (because it contains no moving parts) belonging to the broader category of converters. In particular the transformer to convert the parameters of voltage (V symbol unit [V] volts) and current (symbols The unit [A] amperes) input than output, while maintaining constant the amount of power electrical (less the losses due to hysteresis and eddy currents). The transformer is a machine able to operate only in alternating current, because it exploits the principles of electromagnetism linked to variable flows. <span>The transformer has paramount importance in today's world: without it, the electricity transmission grids that connect power plants to millions of homes and industries could not function</span>
8 0
3 years ago
Other questions:
  • Earthquake occurs because of ?
    11·2 answers
  • Which are limiting nutrients for plant growth?
    10·2 answers
  • All connective tissue is formed from which embryonic germ layer?
    9·1 answer
  • An earthquake causes a one hundred mile square area to be fractured into four different geographical areas. Two of the areas hav
    10·1 answer
  • What are pieiotrophic genes?
    15·1 answer
  • 3. Describe the working of the body's nonspecific defenses<br> against disease.
    15·1 answer
  • scientists estimate that only 1 percent of prokaryotes can be grown in the lab. what does this suggest about our knowledge of ba
    5·2 answers
  • what term refers to a situation where a single phenotypic character is determined by the additive effects of two or more genes?
    7·1 answer
  • Which career would best suit Callie's interests in the scenario below?
    15·1 answer
  • NO LINKS AND NO GUESSES I WANT A COMPLETE ANSWER
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!