1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
14

PLS HELP ME WITH THIS!!! What is the nucleotide sequence of the mRNA strand you built?

Biology
2 answers:
Shalnov [3]3 years ago
8 0

Answer:

AUG CUG ACC UAG

Explanation

If this question is on the gizmo "RNA and Protein Synthesis" then this is the answer for that.

Ad libitum [116K]3 years ago
5 0

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

You might be interested in
The causative agent for malaria is a type of? a. rickettsial agent. b. protozoa. c. bacterium. d. prion. e. virus.
irinina [24]

b. protozoa

One of the four species of protozoan in the genus Plasmodium is responsible for the acute or subacute infectious disease known as malaria.

<h3>A virus or a bacteria causes malaria?</h3>
  • A virus or bacteria cannot cause malaria.
  • Plasmodium, a parasite that often spreads through infected mosquitoes, is what causes malaria.
  • A mosquito consumes Plasmodia that are present in blood when it feeds on an infected human.
<h3>How do protozoa cause malaria?</h3>
  • The female anopheles mosquito bite is the primary method of transmission of malaria, a protozoan infection of the red blood cells.
  • The Plasmodium genus of protozoa is what causes malaria.
  • Four different types of malaria parasites can infect people: Plasmodium malariae, vivax, ovale, and falciparum

learn more about malaria here

brainly.com/question/2685790

#SPJ4

3 0
2 years ago
Please help I'll give brainliest ​
Vesnalui [34]

The second option: meiosis and fertilization

process A is meiosis, you can see that the gamete(haploid cell) results from the diploid cell. The gamete has n chromosomes(39), whereas the diploid cell has 2n(78)

process B is fertilization the two gametes(haploid) fuse together to form the zygote(diploid)

7 0
3 years ago
Read 2 more answers
What are some activities that cells engage in that require energy? And from where do cells obtain the energy they need to make A
malfutka [58]
Some activities that cell requires energy may include cell division, active transport, protein synthesis etc.
In human, Cells get their energy by the food we eat. The nutrients in the food breaks down into soluble and simple molecules in stomach and small intestine and it is absorbed through the small intestine and assimilated into the cells, becoming part of it, providing the uses for each type of nutrient. And of course, many of them is the energy source.
8 0
3 years ago
Similarities and differences between RNA and DNA?
Lilit [14]
DNA and RNA both contain a cyclic nitrogenous base, a posphate group and a five-carbon sugar.  These are the base units of nucleotides which make up nucleic acids.  DNA contains the nitrogenous bases; adenine, thymine, cytosine and guanine wheresas RNA contains the bases; adenine, thymine, cytosine and urasil.  DNA codes for the nucleotides in an RNA molecule, whereas DNA codes for the amino acid sequence in a protein 
3 0
3 years ago
True or False All algae reproduce only by sexual reproduction.
Kamila [148]

Answer:

False

Explanation:

algae is counted as a plant which means they are also asexual

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following correctly describes how a diagram of cellular respiration would differ from a diagram of photosynthesis?
    9·2 answers
  • Osmosis is the diffusion of small molecules. -------------------------------------------------------------------------------- Tr
    11·1 answer
  • 4.) Photosynthesis is often described as two series of reactions, the light dependent and the light-independent or Calvin cycle
    12·1 answer
  • All microorganisms that regularly populate the human body are referred to as the ___________________..
    6·1 answer
  • In one publication, the author implanted biomaterials subcutaneously in rats to test the biocompatibility of materials. At a few
    12·1 answer
  • 12. Study the image of a chromosome. Which of the following statements about
    13·2 answers
  • Which term refers to the fact that naturally occurs omg he universe
    6·1 answer
  • How is the age distribution pattern of the Hawaiian Islands - Emperor Seamount chain explained by the position of the Hawaiian h
    11·1 answer
  • Which of these is NOT a function of tentacles? *
    8·1 answer
  • What is reproduction kcu-uzyp-wdj g I r ls c o me pls​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!