1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
14

PLS HELP ME WITH THIS!!! What is the nucleotide sequence of the mRNA strand you built?

Biology
2 answers:
Shalnov [3]3 years ago
8 0

Answer:

AUG CUG ACC UAG

Explanation

If this question is on the gizmo "RNA and Protein Synthesis" then this is the answer for that.

Ad libitum [116K]3 years ago
5 0

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

You might be interested in
When you perspire on a hot humid day drinking water will restore?
OverLord2011 [107]
Fluids, water, You loose salt water and electrolights when you perspire, when you drink water it doesn't have salt or electrolights it just has water so it can only replace your water
4 0
4 years ago
What are two major parts of compound microscope?​
mariarad [96]

Answer:

a).eyepiece lens.

b).tube

7 0
3 years ago
Read 2 more answers
gets rid of cell waste by breaking down large molecules into smaller ones for the cell to excrete. The helps these waste molecul
Aleonysh [2.5K]

Answer:

Lysosomes I believe are the parts of a cell that gets rid of waste.

7 0
4 years ago
Which question can be answered by science?
tekilochka [14]

Answer: B. Does this medicine reduce fevers?

Explanation: This is because you can run experiments and use the scientific method to answer your question.

5 0
3 years ago
Read 2 more answers
Fill in the following blank answers :
Marat540 [252]
A: white oak
b: cottonwood
c:american elm
d:silver maple
e:black willow
f:green oak
4 0
3 years ago
Other questions:
  • I will reward brainliest !
    6·1 answer
  • Within a single use of the scientific method, which of the following steps can only be performed after data is collected? A. The
    5·2 answers
  • The water cycle consists of some water evaporating from the surfaces of bodies of water and going into the air. As result of air
    13·1 answer
  • What’s a large muscle that controls the lungs?
    8·2 answers
  • Chicken pox is a virus that causes an itchy rash but typically does not have any major or lasting effects on an infected person.
    6·1 answer
  • Many insects have a tough outer shell called _____. an exoskeleton cellulose an endoskeleton chitin
    7·1 answer
  • B. How does weathering affect Earth's surface?
    8·1 answer
  • Why are fracking liquid waste pools harmful to the environment?
    13·1 answer
  • I NEED HELP ASAP<br> click on the picture to help
    15·1 answer
  • List 2 abiotic factors in the rainforest
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!