1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
14

PLS HELP ME WITH THIS!!! What is the nucleotide sequence of the mRNA strand you built?

Biology
2 answers:
Shalnov [3]3 years ago
8 0

Answer:

AUG CUG ACC UAG

Explanation

If this question is on the gizmo "RNA and Protein Synthesis" then this is the answer for that.

Ad libitum [116K]3 years ago
5 0

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

You might be interested in
A hypothesis determines ...
statuscvo [17]

Answer:

the correct answer would be C.

Explanation:

it would be C because a hypothesis is your guess of what the results will be. once you test the product you will figure out if your hypotheses was correct or not.

i hope this helps you out!!

-AlphaWolfie-

8 0
3 years ago
HELP PLEASE!
Andrei [34K]
The answer is A.) Troposphere, Stratosphere, Mesosphere, Thermosphere
6 0
3 years ago
Read 2 more answers
How have scientist started to study relationships between different groups of organisms?
Delicious77 [7]
<h2>Answer:</h2>

The scientist started to study relationships among various groups of organisms <u>C. by using genetic analyses</u>.

<h2>Explanation:</h2>

The following features were used to study about the relationships between different groups of organism:

  • External morphology
  • Similarities in structure
  • Genetic analysis
  • Chemical composition

The molecular similarities in the structure of RNA, DNA, and proteins help to establish the relationship of relationships between different groups of organisms. This was studied through testing the samples obtained by organisms using genetic analyses.

7 0
3 years ago
Why are earthquakes good to our community?
steposvetlana [31]
Let’s scientists learn more about the environment and how the world works
6 0
3 years ago
Just help if you can be very appreciated :) thank you
prohojiy [21]

Answer:

1. ) Litre - Basic metric unit of volume

2.) Metric system - Used by science and the rest of the world

3.) Gram - Basic metric unit of mass

4.) British system - System of pounds , feet and gallons

5.) Meter - Basic metric unit of length

Hope this helps you

6 0
4 years ago
Read 2 more answers
Other questions:
  • A strand of dna contains the base sequence agtt. what is the sequence of the complementary strand of dna?
    5·2 answers
  • Which is the definition of taxonomy
    14·1 answer
  • Gravity moves rocks and soil uphill true or false?
    5·2 answers
  • Which organisms could be classified as a plant
    11·1 answer
  • Definiton of crossing over
    13·2 answers
  • If you receive 2 of the same alleles from your parents, what will this determine
    6·1 answer
  • Is aminalia unicellular or multicellular ?????
    13·1 answer
  • Plz! Its about starss!! Look at the HR diagram below with four stars labeled.
    9·2 answers
  • 01) How is aerobic respiration similar to combustion?
    11·2 answers
  • Why do bans on ivory trade not stop elephants<br> from being slaughtered?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!