1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
14

PLS HELP ME WITH THIS!!! What is the nucleotide sequence of the mRNA strand you built?

Biology
2 answers:
Shalnov [3]3 years ago
8 0

Answer:

AUG CUG ACC UAG

Explanation

If this question is on the gizmo "RNA and Protein Synthesis" then this is the answer for that.

Ad libitum [116K]3 years ago
5 0

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

You might be interested in
Either needs to be<br> (created<br> or<br> for you to<br> survive
Citrus2011 [14]
This is the Definition of coevolution
6 0
2 years ago
Please answer!!
Mariana [72]

Answer:

C. Immune system

Explanation:

7 0
3 years ago
Read 2 more answers
How many elements in nature are there and what are they
bija089 [108]

Well there's Water, Earth, Fire, and Air. Not quite sure how this would be a school question. But here it is.

8 0
2 years ago
What are the steps in drawing conclusions
julsineya [31]
Sum everything up that you have written e.g.
This data shows that children of the 80’s grew up to be the most fun.

7 0
2 years ago
If the blood plasma had antibody A what type of blood would the immune system attack
Luba_88 [7]

Answer:Autoimmune hemolytic anemia. Known as AIHA, this condition occurs when the immune system creates antibodies that destroy red blood cells. Because red blood cells carry oxygen to the body's tissues, AIHA can result in a reduced amount of oxygen in the body.

4 0
2 years ago
Other questions:
  • The diversity of organisms present on earth is the result of
    9·1 answer
  • Which of the following statements best describes the structure and function of a carbohydrate
    14·2 answers
  • Why is glucose not a direct source of cellular energy?
    11·1 answer
  • The scientific attitude requires an open-minded humility because it involves a willingness to
    9·1 answer
  • The active ingredient in the conversion of organic material into alcohol is
    7·2 answers
  • In which part of the nephron are sodium and chloride ions actively reabsorbed?
    6·1 answer
  • Living things need to maintain their internal environment . This is known as homeostasis What role does homeostasis play in cont
    7·1 answer
  • A population of rabbits inhabits an island that has an active volcano. The volcano erupted and covered the island destroying mos
    7·2 answers
  • a group of primitive cells that have the same number of mitosis all daughter cells that result from mitosis meiosis gametogenesi
    14·1 answer
  • Which statement best describes a scientific theory?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!