1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
14

PLS HELP ME WITH THIS!!! What is the nucleotide sequence of the mRNA strand you built?

Biology
2 answers:
Shalnov [3]3 years ago
8 0

Answer:

AUG CUG ACC UAG

Explanation

If this question is on the gizmo "RNA and Protein Synthesis" then this is the answer for that.

Ad libitum [116K]3 years ago
5 0

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

You might be interested in
What makes the ore bauxite special
wel
Bauxite does not have a specific composition. it's a mixture of hydrous aluminum oxides, aluminum hydroxides, clay materials, and insoluble materials such as, quartz, hematite, magnetite, siderite, and goethite
6 0
3 years ago
Read 2 more answers
List the levels of space from smallest to largest.
Y_Kistochka [10]
Troposphere
Stratosphere
Mesosphere
Thermosphere
Exosphere
4 0
3 years ago
Which is an example of positive gravitropism?
AveGali [126]

Answer:

c. the plant root growing down into the soil

Explanation:

The plant root going down deep into the soil is an example of positive gravitropism. Gravity pulls everything towards the center of earth i.e. downwards and roots follow the direction of gravity automatically by growing downward towards soil that is why it is known as positive gravitropism. In short we can say that root favors the direction of gravity.

Shoot on the other hand show negative geotropism/gravitropism i.e. it grows towards the opposite direction of gravity. Shoot grow towards upside direction i.e. away from the surface towards sky.

4 0
3 years ago
Which mechanism of harm presents the greatest immediate threat at hazmat incidents?
uysha [10]

Answer:

D.

Explanation:

it should be the energy release. I think that it’s this because, energy being released I think can cause death.

3 0
2 years ago
According to the concept of punctuated equilibrium, the "sudden" appearance of a new species in the fossil record means that ___
jek_recluse [69]
Do you have different answers that go with the question?
3 0
3 years ago
Other questions:
  • A mineral forms from water at the edge of a lake. Which statement best describes this mineral? The mineral formed from lava. The
    10·2 answers
  • A pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance
    7·1 answer
  • Human blood type is determined by several alleles: A, B, and O. This is an example of what?
    14·2 answers
  • Which characteristic do ferns have that mosses do not?
    7·1 answer
  • When NADH passes its electrons into the Electron Transport System, NADH is chemically:
    9·1 answer
  • Which is true concerning how fossils are used as evidence?
    15·2 answers
  • WORTH 15 PTS!!!!
    5·2 answers
  • If you stab a cereal box does that mean your a cereal killer
    6·1 answer
  • How many chromosomes are in a typical human body cell?
    15·1 answer
  • Look at the picture<br>​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!