1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
14

PLS HELP ME WITH THIS!!! What is the nucleotide sequence of the mRNA strand you built?

Biology
2 answers:
Shalnov [3]3 years ago
8 0

Answer:

AUG CUG ACC UAG

Explanation

If this question is on the gizmo "RNA and Protein Synthesis" then this is the answer for that.

Ad libitum [116K]3 years ago
5 0

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

You might be interested in
In the experiment, you will determine whether
Svet_ta [14]

1. grow more

2.do organisms make plants grow faster

3. what type of organism supports the plant the best

7 0
2 years ago
24. An investigator examines voltages resulting from changes in membrane permeabilities. If the cell membrane suddenly had 100 p
omeli [17]

Answer:

Generally, K+ ions ensures re-polarization of  the membrane potential. It always ensures that the neuron returns its resting  state, protecting the  neurons and ensuring episode of rest before the next action potential.

K+ does this by leaving the axon, making the inner layer more negative. This is resting membrane potential. Because there are many K+ channels for leakages out of the neuronal axons.

Therefore, in this scenario, he neuron will return to its resting membrane potential state which between values -50 to -75mV.

Therefore the value of the potential will be -60mV, or within the range of -50 to -60mV. This is because the neuron is is non- excitable.

Explanation:

7 0
3 years ago
Why are nutrients important to the organism?
Nina [5.8K]

Answer:

<em><u>Nutrients help break down food to give organisms energy</u></em>

Explanation:

Nutrients are chemical substances found in every living thing on Earth. They are<em> necessary</em> to the lives of people, plants, animals, and all other organisms. <u><em>Nutrients help break down food to give organisms energy</em></u>. The human body can also synthesize some nutrients, such as <em>amino acids</em>.

6 0
3 years ago
Read 2 more answers
List the 3 steps of cellular respiration in order from beginning to end
enot [183]
Step 1: glucose is broken down into 2 molecules of pyruvate
Step 2: Completes breakdown of carbon dioxide, makes small amounts of ATP, provides electrons
Step 3: electron transport chain, chemiosmosis; energy from electrons-- produces 32 ATP
3 0
3 years ago
Read 2 more answers
Which organism impacts their environment the most?
Vlad [161]

Explanation:

What environment is it?

4 0
3 years ago
Other questions:
  • Do y'all teacher make y'all use that Rocketbook app? How do I use it?
    12·2 answers
  • Give a basic definition of evolution. <br><br> A paragraph long please :)
    7·1 answer
  • If one species is split into two populations in two different places, natural selection may drive them to become two different s
    9·1 answer
  • Organisms get the energy that the y need from?
    15·1 answer
  • What causes the water currents through the crayfish
    15·2 answers
  • What part of the hemoglobin molecule is eventually metabolized to stercobilin in the feces?
    15·1 answer
  • During which process is energy released 1. external respiration 2. internal respiration
    7·1 answer
  • When is an animal most likely to enter into dormancy (hibernation kestivation)?
    10·1 answer
  • What is an allele and how does it relate<br> to a chromosome, a gene, and a trait?
    6·1 answer
  • Blank alleles will show in your phenotype even if it has one copy
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!