1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zepler [3.9K]
3 years ago
13

Which of these organelles is covered in ribosomes?   A. Golgi apparatus   B. Large vacuoles   C. Rough endoplasmic reticulum   D

. Smooth endoplasmic reticulum
Biology
2 answers:
Vladimir79 [104]3 years ago
8 0

Answer:

(C).Rough endoplasmic reticulum

Explanation:

Endoplasmic reticulum (ER) is a membrane-bound cell organelle, present in eukaryotic cells. There are two types of endoplasmic reticulum, smooth ER and rough ER.  

Rough ER contains ribosomes on its outer surface (side, which is in contact with cell cytosol), while in smooth ER surface, ribosomes are absent. This is because ribosomes provide platform for the process of protein synthesis or translation.

Proteins synthesized by ribosomes present in rough ER surface are then transported to it (rough ER) for sorting and  post-transnational modifications.

Thus, the correct answer is option (C).

 

Flura [38]3 years ago
6 0
C. rough endoplasmic reticulum
You might be interested in
_________7. During strenuous exercise, skeletal muscles use up ___________ and produce large amount of ________, which causes pa
DanielleElmas [232]

Answer:

A. Oxygen, lactic acid

3 0
3 years ago
Which of the following is not a cause of cell necrosis? a. Infection b. Blood clot c. Injury d. Perfusion
SIZIF [17.4K]
B is the answer.......
4 0
3 years ago
Read 2 more answers
Select all the correct ones (Choose 3): *
Korolek [52]
Answer:
-The moon orbits the Earth
-The Earth orbits the Sun
-The Moon orbits the Earth but not the sun
5 0
3 years ago
Read 2 more answers
Why is hemophilia not a mendelian trait?
riadik2000 [5.3K]

Answer:

C.

Explanation:

Hemophilia could not be a Mendelian trait, due to it being a recessive X-linked trait. This is also why Hemophilia is more common in males.

5 0
3 years ago
What do metabolism, respiration, and digestion have in common?
Montano1993 [528]
Metabolism, respiration and digestion are all complex chemical processes involving many steps, happening in 3 dimensional space within cells. Metabolism is the breaking of bonds within food molecules (like sugar) to harness energy for cellular work; respiration involves moving oxygen and carbon dioxide gases between cells to facilitate cellular metabolism and digestion involves breaking down food macro structures into smaller units suitable for metabolism.

So the answer is D - each of the three process involve multiple chemical reactions.
7 0
3 years ago
Read 2 more answers
Other questions:
  • How do the cell walls of the Archaea compare to the cell walls found in Bacteria?
    13·2 answers
  • How will the cardiac output change if you double the heart rate but reduce the stroke volume by one-half? how will the cardiac o
    11·1 answer
  • Louisa put a bowl of water and a bowl of sand in the sun. She put a thermometer in each bowl. Then she recorded the temperature
    9·1 answer
  • In the 1960s, even though most of his friends tried recreational drugs, Sebastian refused to experiment. He did not think drugs
    10·1 answer
  • Can mold make u sick ​
    15·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How do plants overcome photorespiration?
    6·1 answer
  • What are stem cells?
    12·1 answer
  • What do elephants use for energy
    9·2 answers
  • The scientific definition of ______ refers to changes in a species or population over time. systematics genetics evolution biolo
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!