1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paraphin [41]
3 years ago
13

A researcher is studying the external plates of marine dinoflagellates to improve the taxonomy of these members of the phytoplan

kton. Which microscope would be ideal to study these external features at magnifications between 5000-15000X?
Biology
1 answer:
Vera_Pavlovna [14]3 years ago
6 0

Answer:

The correct answer is - scanning electron microscope.

Explanation:

SEM or a scanning electron microscope is that produces an image by an electron beam over the sample surface to scan. The electrons of the beam interact with the sample producing various signals that allow providing information about the composition and topography of the individual sample. The magnification of the SEM is in between 20X to 30000X  

Thus, the correct answer is - scanning electron microscope.

You might be interested in
Each P1 parent of a monohybrid cross has completely identical genes<br> ture<br> false
lawyer [7]

Answer:

False.

Explanation:

Monohybrid cross may be defined as the cross done by taking the single character at the time. The monohybrid cross explains the concept of dominance and law of segregation.

The P1 parent of monohybrid cross doesnot have completely identical genes. This can be explained by the cross shown below:

Parent         Tt           ×       tt

Gamete         T  t           ×     t

Here, the parents are not identical.  

Thus, the answer is falsi.      

8 0
3 years ago
Explain the phenomenon of photorespiration, including why it is thought to occur (evolutionarily speaking), and why plants have
liubo4ka [24]

Photorespiration limits casualty products of light reactions that build up in the absence of the Calvin cycle. In many plants, photorespiration is a problem because on a hot, dry day it can drain as much as 50% of the carbon fixed by the Calvin cycle.  The closing of stomata reduces access to CO2 and causes O2 to build up. These conditions favor a seemingly not useful process called photorespiration.  In most plants (C3 plants), initial fixation of CO2, via rubisco, forms a three-carbon compound.  In photorespiration, rubisco adds O2 instead of CO2 in the Calvin cycle. Photorespiration eats up O2 and organic fuel and releases CO2 without producing ATP or sugar. Photorespiration can evolve relic because rubisco first evolved at a time when the atmosphere had far less O2 and more CO2. 

4 0
3 years ago
insulin-dependent diabetics depend upon what microorganisms to produce the human protein that they rely upon to uptake glucose f
Nata [24]
They rely on transgenic microorganisms
8 0
3 years ago
Body's major metabolic hormone is called
Temka [501]
Body's major metabolic hormone is called Thyroid hormone
5 0
3 years ago
Desalinating salt water is one way arid regions are able to obtain drinking water. however, it's not an easy process.
Leya [2.2K]
Drinking Salt water would dehydrate you making you more thirsty and eventually you'd die. You could desalinate small amounts of water by distillation with the appropriate tools all you'd need to do is heat the salt water and catch the vapor/steam in a different container. This could be done slowly using heat from the sun and clear plastic water bottles if no other heat sources are available. the salt stays in the heated container while the vapor/steam is desalinated drinking water.
7 0
3 years ago
Other questions:
  • Can someone help me with this please
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Kina’s husband comes home from work angry because of an argument he had with his boss. Subsequently, Kina’s husband begins yelli
    14·1 answer
  • during mitosis and meiosis, DNA is duplicated, chromosomes separate, and cytoplasm divides. how are mitosis and meiosis differen
    6·1 answer
  • Which of the following is true about protein molecules? A. Protein molecules are made up of strands of DNA joined together by am
    14·1 answer
  • No more than _____________ of your total calories should come from saturated fats.
    15·1 answer
  • T
    6·1 answer
  • Please answer asap!
    15·1 answer
  • Within the human body, what process demonstrates the Law of Conservation of Energy?
    8·1 answer
  • The diploid generation of the life plant cycle _________________.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!