1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vichka [17]
3 years ago
7

Red flowers (r) and white flower (w) are crossed to produce a pink flower (rw). what is the probability of a red flower, if 2 pi

nk flowers are crossed?
Biology
1 answer:
Dafna11 [192]3 years ago
7 0
I think the probability will be 0 then.
You might be interested in
Which stage of the cell cycle involves the division of the cell’s nucleus?
irinina [24]

Metaphase

At the end of the phase the cell divides into two new cells

3 0
3 years ago
What are the type of germination in plant​
Pavlova-9 [17]

Answer: Hypogeal Germination and Epigeal Germination

Explanation: Facts

4 0
3 years ago
A fertilizer company is trying to find a new herbal pesticide to add to its product. Company managers know that peppermint oil o
wlad13 [49]

Answer:

Peppermint oil and morning, peppermint oil and night, lavender oil and morning, lavender oil and night

Step-by-step explanation:

Fertilisers are substances, which could be organic or inorganic, that is added to soil to increase crop yield.

Pesticide can be defined as substances that are used to control pests in an environment. Example of a pesticide includes:

- fungicides,

- herbicides( these are used to kill unwanted plants) and

- insecticides.

From the existing knowledge that the time of day the fertilizer is applied, morning and night affects the pesticide, and the Company managers know that peppermint oil or lavender oil will be used.

The insects should be subjected to the following treatments to effectively compare all combinations of these choices listed above:

- Peppermint oil and morning,

- peppermint oil and night,

- lavender oil and morning,

- lavender oil and night

8 0
3 years ago
Which statement best represents how structure relates to function? a. Some insects live longer than others. b. Many tropical bir
Harlamova29_29 [7]
If we are not there we will be done by then I can go to the movies with him tomorrow and I can do a
5 0
3 years ago
Read 2 more answers
All life must maintain an internal balance, despite environmental changes. This is called
zubka84 [21]
Ying and yang is the answer to the question
7 0
3 years ago
Other questions:
  • If a patient has 12 of their body covered with a psoriasis rash what would be the severity
    13·1 answer
  • Which of the following biomes are considered temperate biomes?
    6·1 answer
  • Which of these is an advantage of using models to study tectonic plate movements?
    14·2 answers
  • Matter is composed of? ANSWER NOW PLEASE WILL MARK BRAINLIEST
    8·1 answer
  • The following is a list of the steps that occur in the production of an auditory sensation. The pressure wave distorts the basil
    11·1 answer
  • Three genes in fruit flies affect a particular trait, and one dominant allele of each gene is necessary to get a wild-type pheno
    7·2 answers
  • What is the estimated age of Earth?<br> A.4.6x10^6 <br> B.4.6x10^7<br> C.4.6x10^8<br> D.4.6x10^9
    15·2 answers
  • Infiltration is the process that helps to add water to the Earth's
    15·1 answer
  • What are the functions of a dendron
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!