The answer to this question is D: Psychoactive. It is the world's most widely consumed psychoactive drug.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Cell Membrane
Hope this helps =]
The seeds an evolutionary advantage for seed plants because seeds develop into adults without sxual reproduction.
<h3>What is the evolutionary importance of the seed?</h3>
Seeds play an important role in the dispersion of plant species, that is, they ensure that plants spread throughout the environment. In addition to guaranteeing a greater area of domain for the species, competition between the newly born plant and the mother plant is also avoided.
Seeds allow the expansion of a type of plant around the world in addition to being a form of asexual reproduction that makes it unnecessary to join gametes.
See more about seeds at brainly.com/question/15976369
#SPJ1
