Answer:
B. Storing energy
Answer:
Reverse Osmosis.
Explanation:
This is the mechanisms of water purification for drinking water which is droven by the chenical potential of the solvent .
It involves the use of partiaiy permeable membrane to allow ions , water molecules ,solvent molecules to pass through during purification
A pertial permiable menenrane in this prurifiction process is the membrane that allow only water molecules, ions and restricted other unwanted chemical contaminants from passing through it.
The right option is a. contour interval
The difference in elevation between the highest and lowest contour lines on a topographical map is called contour interval.
A contour interval is the vertical distance between the two contour lines (highest and lowest) in a topographical map. The contour interval is usually stated explicitly on the right-hand lower part in every map. 20 feet for a 1:24,000 map scale is the frequently used contour interval and different contour intervals is available for different maps.
Answer:
B)
Explanation:
"Positive feedback encourages and intensifies a change in the body's physiological condition, driving it farther out if the normal range."
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.