1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kisachek [45]
3 years ago
11

"Spent" nuclear fuel rods come out of a reactor and need to be handled carefully. Why must power plants spend so much money and

be so cautious in dealing with these materials? A) Spent nuclear fuel is very fragile and can shatter easily and damage equipment. Eliminate B) Spent nuclear fuel is highly unstable, and likely to explode without precautions. C) Spent nuclear fuel is highly radioactive and can damage organisms and the environment. D) Spent nuclear fuel is very expensive, and some people desire to take some and profit from it.
Biology
2 answers:
Sedbober [7]3 years ago
7 0
The answer to your question is C

uysha [10]3 years ago
6 0

Answer:

C) Spent nuclear fuel is highly radioactive and can damage organisms and the environment.

Explanation:

Spent nuclear fuel rods are held in under water pools for decades to cool them off. The circulating water removes the heat away from the fuel rods. Also water acts as a good radioactive shield as fuel rods are still highly radioactive. Eventually after many years when fuel rods are inert thy can be moved to dry casks.  

You might be interested in
What is one of the primary functions of this food in the body?
erma4kov [3.2K]
Answer:

B. Storing energy
4 0
3 years ago
Which process works by applying pressurized water against a semi-permeable membrane that traps salts and other minerals?
Natali5045456 [20]

Answer:

Reverse Osmosis.

Explanation:

This is the mechanisms of water purification for drinking water which is droven by the chenical potential of the solvent .

It involves the use of partiaiy permeable membrane to allow ions , water molecules ,solvent molecules to pass through during purification

A pertial permiable menenrane in this prurifiction process is the membrane that allow only water molecules, ions and restricted other unwanted chemical contaminants from passing through it.

5 0
3 years ago
The difference in elevation between the highest and lowest contour lines on a topographical map is called: a. contour interval c
Andrew [12]

The right option is a. contour interval

The difference in elevation between the highest and lowest contour lines on a topographical map is called contour interval.

A contour interval is the vertical distance between the two contour lines (highest and lowest) in a topographical map. The contour interval is usually stated explicitly on the right-hand lower part in every map. 20 feet for a 1:24,000 map scale is the frequently used contour interval and different contour intervals is available for different maps.  


7 0
3 years ago
Read 2 more answers
Positive feedback
choli [55]

Answer:

B)

Explanation:

"Positive feedback encourages and intensifies a change in the body's physiological condition, driving it farther out if the normal range."

4 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Other questions:
  • Are there more adults(18 or over) than kids in this world?
    15·2 answers
  • A gene is a subunit of information on a chromosome true or false?
    9·2 answers
  • Why are hurricanes considered more damaging than tornadoes when tornados have stronger winds?
    15·1 answer
  • Swimmers itch is an initial symptom of which of the following?A. tularemiaB. schistosomiasisC. Chagas diseaseD. Lyme diseaseE. m
    15·1 answer
  • Explain what a second messenger molecule’s role is in signal transduction, and give an example. Describe how signal information
    12·1 answer
  • Which of the following nonmetallic mineral resources is use both as A building material and and industrial mineral
    14·1 answer
  • The main site for photosynthesis in plants is the
    15·1 answer
  • Explain briefly the 3 stages of theory development​
    15·1 answer
  • 50 points all three please asap
    12·1 answer
  • How to do a dichotomous key
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!