1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sineoko [7]
3 years ago
12

What is a strategic mineral?

Biology
2 answers:
SSSSS [86.1K]3 years ago
6 0
The answer is B

<em>Let me know if you have any other questions! ♥</em>
Veseljchak [2.6K]3 years ago
5 0
Your answer would be B. Hope this helped :)<span />
You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
What is olfactory receptor????<br><br><br>First time....3rd​
Bumek [7]

Answer:

It is a type oe of receptor present in our body

Explanation:

It's is a type of receptor located in our noses which Helps us to smell different things. Some times when we get a cold the olfactory receptors get blocked and this prevents us from smelling things. And this also effects our sense of taste

3 0
3 years ago
Read 2 more answers
Which activity will create tension in the legs?
-BARSIC- [3]
A. Stretching your legs before a run. You're creating tension by applying force to  pull your tendons and ligaments. 
4 0
3 years ago
Read 2 more answers
If the Whole Brainers of 1850 could see an fMRI, would it support or contradict their theory? Include evidence from both texts t
Yuki888 [10]

Answer:

You have to put a photo rq

4 0
3 years ago
Read 2 more answers
Which of these products is formed during the metabolic reactions of cellular respiration?
timama [110]

the correct answer is water

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following does not occur during mitosis
    8·1 answer
  • Which of the following are parts of a feedback loop?
    7·2 answers
  • The left ventricular wall of the heart is thicker than the right wall in order to ____.
    6·1 answer
  • Reactants of photosynthesis
    11·2 answers
  • Definition of glycerol​
    11·2 answers
  • The _____ was a direct result of the Industrial Revolution.
    13·1 answer
  • An empty paper cup is the same temperature as the air in the room. A student fills the cup with cold water. Which of the followi
    13·1 answer
  • What effect did the zebra mussels have on the phytoplankton in the Hudson River ?
    9·1 answer
  • b. Describe how an effort to preserve a species of elephant could affect an area where elephants have been hunted extensively. (
    14·1 answer
  • Development of a multiplex real-time PCR assay for the simultaneous detection of four bacterial pathogens causing pneumonia
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!