1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lions [1.4K]
3 years ago
6

Neural crest cells appear on the edges of the neural tube and spread throughout the embryo, giving rise to all of the following

structures except __________.
A) sensory capsules in which eyes and other sense organs develop
B) pharyngeal slits (or clefts) of invertebrate chordates
C) some of the bones and cartilage of the skull
D) several types of neurons
E) teeth
Biology
1 answer:
Andre45 [30]3 years ago
5 0

Ans.

Neural crest cells are embryonic cells that are unique to organisms of phylum chordata. These cells give arise a number of cell lineage, such as bone and cartilage, melanocytes, smooth muscle, glia and neurons, eyes, teeth, and other sense organs. The neural crest cells do not form pharyngeal slits in invertebrate chordates.

Thus, the correct answer is option b).

You might be interested in
Which statement explains why oxygen molecules easily diffuse across a cell membrane while glucose molecules do not?
Artemon [7]
Oxygen molecules diffuse fast because the main gas in a cell in Carbon Dioxide its like if it was 99.9 percent carbon that .1 percent is oxygen and carbon dioxide being what it is. Automatically overrides the amount of oxygen. Basically it is nonpolar
4 0
3 years ago
Read 2 more answers
Which state of california uses a mechanism known as ___ to rehabilitate chronic violators of driving laws?
kiruha [24]

The State of California uses a mechanism known as "NOTS" to rehabilitate chronic violators of driving laws.  The Negligent Operator Treatment System (NOTS) is based on negligent operator points and consists of a computer-generated series of warning letters and progressive sanctions against the driving privilege.

<span> </span>

3 0
3 years ago
Ann, bob, and charlie are testing to see if putting sugar in water helps flowers last longer. They buy six roses and place three
Ne4ueva [31]

Run more trials for the experiment to ensure that the small difference is not significant. B

3 0
2 years ago
What are the five functions of the human skeleton?
olga2289 [7]

Answer:

Support, movement, protection, blood cell production, calcium storage and endocrine regulation

Explanation: that’s what makes us survive.

4 0
3 years ago
Mitosis produces A. four cells, each with
Yuki888 [10]
When a cell divides by way of mitosis, it produces two clones of itself, each with the same number of chromosomes. When a cell divides by way of meiosis, it produces four cells, called gametes. Gametes are more commonly called sperm in males and eggs in females.
6 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How do mutations increase the genetic variation within a species?
    9·1 answer
  • What are seven characteristics that make a living thing different from non-living things
    12·1 answer
  • Which like forms would have been among the first organisms on earth
    7·1 answer
  • SA nodal cells are unique in that they exhibit autorhythmicity, meaning they are capable of depolarizing and firing an action po
    8·1 answer
  • Why is the sky blue?
    5·2 answers
  • Very cold periods in earths history resulted in which of the following?
    15·2 answers
  • Enzymes and pH<br> 2. What is the pH scale?
    15·2 answers
  • What are endotherms , no links please ,thank you
    8·2 answers
  • We can mold metals into different shapes because they are _____________.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!