1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nitella [24]
3 years ago
13

Mitosis and meiosis are processes by which animal and plant cells divide. Which statement BEST describes a difference between mi

tosis and meiosis?
A.Meiosis is a multi-step process.

B. Meiosis also takes place in prokaryotic cells.

C. Mitosis produces genetically identical daughter cells.
Biology
2 answers:
kicyunya [14]3 years ago
5 0
C.mitosis produces genetically identical daughter cells.
Alex17521 [72]3 years ago
3 0

Answer:

C. Mitosis produces genetically identical daughter cells.

Explanation:

As stated in the question, Mitosis and Meiosis are both cellular divisions that occurs in living cells. However, they differ in their products and process. Mitosis is the type of cell division that produces two daughter cells that are genetically identical to the parent cell. They are identical in the sense that they possess the same number of chromosomes and types of alleles as the parent cell.

However, meiosis is the kind of division that produces four daughter cells with each having their chromosomal number reduced by half. Meiosis is only employed by sexually reproducing organisms to produce gametes. It involves a two step division process. The daughter cells that results from meiosis are genetically different from the parent cell because they contain different allele combination and reduced number of chromosomes as the parent cell.

This difference in genetic content of the daughter cells produced by meiosis is as a result of CROSSING-OVER process that occurs between non-sister chromatids of homologous chromosomes, where chromosome parts containing alleles are exchanged between the two chromosomes. This increases the chance of genetic diversity among the species of that organism.

You might be interested in
Which is the greatest carbon reservoir?<br> A. Geosphere B. Hydrosphere C. Atmosphere D. Biosphere
Dimas [21]

Answer:

Atmosphere

Explanation:

4 0
3 years ago
In what ways do humans use diatoms?​
creativ13 [48]

As diatoms are made from silica this makes diatomaceous earth very abrasive, and so the sharpness enhances the particles as a pesticide. Diatoms are also useful in forensic studies. If a person has drowned then diatoms are able to enter the human body.

3 0
3 years ago
4. scientists are studying photosynthesis in a forest ecosystem that has plants, animals, and decomposers (which consume dead th
olganol [36]

Answer: Plants, animals, and decomposers (which consume dead things) are in a forest ecosystem. Scientists are studying photosynthesis in the forest. Which group or groups of organisms should they study? A jungle ecosystem has plants, animals, and decomposers (which consume dead things).

Explanation:

7 0
2 years ago
This type of map indicates features of the land like oceans, mountains, and forests by using different colors.
ICE Princess25 [194]

Answer:

the answer to this question is: Physical Map.

hope this helps!

Explanation:

6 0
2 years ago
Read 2 more answers
What is the carbon cycle? How does carbon get into our atmosphere? How does it leave?
Ray Of Light [21]
When carbon is exchanged along the biosphere
6 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • It is believed that the coelacanths and lungfish (lobed fin fishes) represent a crucial link between other fishes and tetrapods.
    15·1 answer
  • Under most conditions, the supply of energy by catabolic pathways is regulated by the demand for energy by anabolic pathways. Co
    6·1 answer
  • in the P generation, a tall plant was crossed with a short plant. The short plants reappeared in the F1 generation because ?
    5·1 answer
  • Which activity will create tension in the legs?
    5·2 answers
  • Bacteria divide at a constant time interval called the
    13·1 answer
  • The left ventricle in humans is more muscular than the right ventricle because _________.a. resistance is higher in the pulmonar
    8·1 answer
  • You are studying two linked genes that influence vine height and fruit color in squash. Yellow color is dominant over green, and
    9·1 answer
  • Question is inside the image below.
    11·1 answer
  • Which of the following is needed for cellular respiration?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!