1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
3 years ago
14

Pollution resulting from an oil spill is categorized as point source pollution. true or false?

Biology
1 answer:
Musya8 [376]3 years ago
3 0

Answer:

true

Explanation:

i hope this is what you need

You might be interested in
In a given year, which would result in the greatest increase in population size?
Kay [80]
2. High birth rate, zero death rate, high immigration, zero emigration

This is because birth rate and immigration increase population size, and death rate and emigration decrease population size, so maximizing the former and minimizing the latter are ideal
8 0
3 years ago
Read 2 more answers
Help ASAP!!!! 20 points.
Lelechka [254]

Answer:

5= mRNA is “messenger” RNA. mRNA is synthesized in the nucleus using the nucleotide sequence of DNA as a template. This process requires nucleotide triphosphates as substrates and is catalyzed by the enzyme RNA polymerase II. The process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

6 0
3 years ago
A cell from a turkey wing contains 40 chromosomes, how many chromosomes are there in a unfertilized chicken egg
patriot [66]
20 chromosomes because unfertilised eggs contains half the number of bodily chromosomes
4 0
3 years ago
Which of these vaccines must replicate to stimulate an immune response? hpv9. mmr. mcv4. tdap?
dsp73

The answer is MMR. MMR is a <span>t is usually known a childhood vaccination. The MMR vaccine is generally administered to children around the age of one year. all children, all susceptible people at high risk for disease, adults born in 1957 or later who have no been vaccinated w/ MMR (at least one dose).</span>

6 0
3 years ago
Read 2 more answers
Scientific concepts can be explained through
Shkiper50 [21]
Lots of hand waving as is in the current field of much of molecular biology. Other than that experiments and observations. Basically the utilization of the scientific method and then trying to find the mechanism by which something occurs through even more research/experimentation.
HOPE THIS HELPS
6 0
3 years ago
Other questions:
  • A nurse is counseling the family of an infant who is hiv positive. where is the best place for this infant to receive long-term
    10·1 answer
  • How does photosynthesis help plants meet their basic needs?
    9·1 answer
  • What types of bonds is broken when the dna becomes unzipped
    8·1 answer
  • In peas, plants that are true-breeding for a particular trait must be _____ for that trait.
    5·1 answer
  • Sister chromatids are attached to each other at an area called the
    12·1 answer
  • In the diagram below, list what molecule each of the letters are pointing to. M. N. O. P. Q. R. X. Z.
    7·2 answers
  • , which in
    13·1 answer
  • Place these steps of the insulin signaling pathway in the correct order from insultin is secreted to glucose enters the cell. Pl
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • I'm learning about photosynthesis and cellular respiration and wonder how cellular respiration works for plants.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!