1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
13

What must first occur for transcription to begin? mRNA moves the code from the nucleus to the ribosome for protein production. A

gene is expressed through protein production. RNA polymerase attaches to the promoter. A repressor protein must attach to the operator.
Biology
2 answers:
jasenka [17]3 years ago
4 0

Answer:

RNA polymerase attaches to the promoter

Explanation:

Transcription is the process of synthesis of RNA using DNA as template. RNA polymerase enzyme binds to promoter region of the gene and starts making RNA strands that has complementary nucleotide sequence to DNA template strand. The process stops as the enzyme RNA polymerase encounter terminator sequence of gene.

Gelneren [198K]3 years ago
3 0

DNA to RNA and translation

You might be interested in
Can you pls help me??​
givi [52]

Answer:

photosynthesis

Explanation:

it's how plants produce energy

6 0
3 years ago
Read 2 more answers
What are the weakest of all scientific findings? Group of answer choices Case studies Correlational studies Experimental studies
goldenfox [79]

Answer:

The weakest of all  scientific findings are given by case studies.

Explanation:

Case studies are observational or descriptive studies focalized on the analysis of a particular object (an individual, place, event, etc.) in a specific situation. Beacuse of its descriptive nature, it does not provides information about cause-effect relationships and does not consider the effect of random variations. It is the weakest of all scientific findings.

Correlational studies involves measurements of at least two different variables and try to identify if there is a specific relationship between variables, it means if there is a specific trend in the variation of one variable as a response to the variation in the other one (for example, when the temperature of a given solution increases, the solubility of the solute also increase). Although this kind of studies does not provides information about cause relationships, the trend between variables are well stated.

Experimental studies are the ones in which a researcher makes sure of providing a controled environment and manipulates a particular variable to see responses of one or more different variables. These studies provides well supported information.

Epidemiological studies the purpose to analyze all the factors involved in an epidemic (causes, incidence, evolution, etc.). It includes observational and experimental studies that complement each other. Because of the importance of these reasearch on public health, their scientific findings are well stablished and supported.    

Summarizing, the weakest of all scientific findings are provided by case studies.

6 0
3 years ago
Please help ASAP<br> How can ecosystems benefit from wildfires?
marin [14]

Answer:

Fires often remove alien plants that compete with native species for nutrients and space, and remove undergrowth, which allows sunlight to reach the forest floor, thereby supporting the growth of native species

4 0
3 years ago
Read 2 more answers
Which three components are common to all amino acids
Gnoma [55]
<span> Each </span>amino acid<span> consists of a central carbon atom bonded to a hydrogen atom, a carboxyl group, & an</span>amino<span> group, and a specific side chain. </span>
5 0
4 years ago
What is the target daily intake of carbohydrates for 16 year old?
Lelechka [254]
The daily intake of calories depends on gender, for a 16 year old girl it should be 1800-2400, and for a boy it should be 2,200-3,200. But all of this also depends on their daily activities.
Hope this helps and please name this the brainiest.
8 0
4 years ago
Other questions:
  • Which statement accurately describes the relationship between cytokinesis and mitosis? Mitosis includes interphase and cytokines
    5·2 answers
  • 1) In eukaryotic cells, chromosomes are composed of _____.
    12·1 answer
  • What are the functions of the high-energy electrons in the electron transport chain?
    11·1 answer
  • The northern elephant seal was almost hunted to extinction in the 1800s. By the late 1890s, only about one hundred seals were le
    15·1 answer
  • Every cell contains DNA. The main purpose of DNA is to store the cell's genetic information. How does DNA control the cell?
    8·1 answer
  • Why did a decrease in bone mass lead to increased calcium levels in the blood?
    13·1 answer
  • Is animal scientists part of agriculture
    12·1 answer
  • Mitochondria are cellular organelles that act as the power generators of the cell by converting oxygen and nutrients into ATP. T
    7·1 answer
  • What is a characteristic of the soil in secondary succession, which occurs in an area where the community has been destroyed?
    5·1 answer
  • You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATT
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!