1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nydimaria [60]
4 years ago
15

Compare and contrast dehydration synthesis(condesation) and hydrolysis.

Biology
1 answer:
dexar [7]4 years ago
3 0

Answer:

This

Explanation:

In dehydration synthesis reactions, a water molecule is formed as a result of generating a covalent bond between two monomeric components in a larger polymer. In hydrolysis reactions, a water molecule is consumed as a result of breaking the covalent bond holding together two components of a polymer.Aug 14, 2020

You might be interested in
Explain the antigen-antibody response as it relates to blood groups
Arisa [49]
Antigens are surface proteins found on all cells including blood cells. In the case of blood groups, an individual's blood type reflects the presence or absence of specific antigens. An antigen-antibody response is initiated if the individual receives a transfusion of blood containing antigens that it identifies as being "foreign." Antibodies found in a person's blood bind to the foreign antigen, causing agglutination, or clumping. The antigen-antibody complexes clog the small blood vessels, and the foreign RBCs are lysed, releasing hemoglobin into the bloodstream. The most serious complication of a transfusion reaction is kidney failure due to blockage of the kidney tubules by the hemoglobin molecules.
4 0
3 years ago
Daughter cells that are created through meiosis are genetically _______
Studentka2010 [4]

Answer:

a. identical

Explanation:

8 0
3 years ago
Occurs naturally between organisms living in an environment with limited resources.
Yanka [14]
I think the answer is A. Competition. :)
8 0
3 years ago
Read 2 more answers
The process in which two gametes fuse to make one cell is called _____.
murzikaleks [220]
<span>Gametes are haploid cells that fuses with another haploid cell during fertilization. For human being, the gametes are the egg cells and the sperm cells and human fertilization is the union of a human egg and sperm, which usually occur in the ampulla of the fallopian tube. </span>
4 0
4 years ago
Read 2 more answers
What two scientists established the structure of DNA?
gulaghasi [49]
Watson, Crick, and Rosalind Franklin.
3 0
3 years ago
Other questions:
  • A landform that has high elevation and a more or less level surface is a.....
    14·1 answer
  • Need help now!!!! Will make u extra points
    8·1 answer
  • You respond to a patient whose chief complaint intestinal pain that is described as cramping. when taking the sample history you
    7·1 answer
  • Because the United States has a ____, the only candidates who have a reasonable chance of winning an election are either Republi
    15·2 answers
  • What is the function of topoisomerase? a. relieving strain in the DNA ahead of the replication fork b. elongation of new DNA at
    7·1 answer
  • If an enzyme in solution is saturated with substrate, the most effective way to obtain a faster yield of products is to:a. add m
    6·1 answer
  • Which of the following can occur at breaks in the earth's crust?
    9·1 answer
  • The process of a cell increasing its size, doubling its contents, dividing into 2 independent cell, and repeating the process ov
    12·1 answer
  • Help plz help due in 5 min
    15·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!