1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leva [86]
3 years ago
13

Which is not likely to be studied by a biologist?

Biology
2 answers:
faust18 [17]3 years ago
8 0
The answer is d. clouds
Andrej [43]3 years ago
8 0

Answer: Biologists don't study clouds

Explanation:  Biologists study humans, plants, animals, and the environments they live in

You might be interested in
Gamma-aminobutyric acid (gaba) appears to decrease synaptic transmission and seems related to _______ drugs.
Bogdan [553]

Gamma-aminobutyric acid is also known as GABA. It look as if to decrease synaptic transmission and is actually used in drugs called GABAergic drugs or GABA analogues. These drugs are used as hypnotics, anticonvulsants, tranquillizers and sedatives which seems related to be a depressant type of drug. 

5 0
3 years ago
Food molecules are broken down to release energy in the?
Amanda [17]

Answer:

I hope this helps

Explanation:

will this helps

7 0
3 years ago
How does sexual life cycle increase the genetic variation in a species
SCORPION-xisa [38]

Answer:

The behavior of chromosomes during meiosis and fertilization is responsible for most of the variation that arises in each generation. Three mechanisms contribute to genetic variation arising from sexual reproduction: independent assortment of chromosomes, crossing over, and random fertilization.

3 0
3 years ago
Explain why sponges and cnidarians were the first animals to evolve
malfutka [58]
Once the Earth was full of water (ocean) after volcanic activities the mainland became land ( sorry about my english i am hungarian and i am still learning the language )
6 0
3 years ago
Read 2 more answers
What's a trait that can possibly mask another trait
Evgen [1.6K]

Answer:

recessive

Explanation:

8 0
3 years ago
Other questions:
  • The _____________ has (have) a large role in the regulation of blood pressure.
    11·1 answer
  • Which feature of enceladus and europa would indicate the possible presence of life?
    10·1 answer
  • Science help please and fast
    13·1 answer
  • Match the following terms describing the physical/mecahnical events with the correct phases of the cardiac cycle. Each phase may
    11·1 answer
  • In rabbits, white fur is a recessive trait. Based on this fact, what statement BEST describes this rabbit's genotype?
    15·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which choice describes mitosis?
    14·2 answers
  • What characteristic is common of developing countries? 5a
    5·1 answer
  • The sun’s atmosphere contains the
    15·1 answer
  • Select the correct answer from each drop-down menu.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!