1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naya [18.7K]
3 years ago
10

CAM plants have adapted to arid environments by closing their stomata during the day. However, photosynthesis still occurs. This

is because __________. View Available Hint(s)
A) CO2 is fixed in the bundle-sheath cells some
B) CO2 leaks through the closed stomata
C) CO2 is fixed at night when the stomata are open photosynthesis occurs at night
Biology
1 answer:
Goshia [24]3 years ago
8 0

Answer:

C) CO2 is fixed at night when the stomata are open photosynthesis occurs at night

Explanation:

CAM plants exhibit temporal separation of CO2 uptake and CO2 fixation to reduce the water loss. Air is moist and cooler at night. These plants open the stomata at night to allow the CO2 to enter the leaf cells. The entered CO2 is fixed into oxaloacetate which in turn is reduced into malate and is stored in vacuoles. Stomata remain closed during day time to prevent water loss. Decarboxylation of malate releases CO2 which in turn enters the C3 cycle to form glucose.

You might be interested in
1.Wymień środowiska życia mchów.
Tresset [83]

Answer:

sadasdasdadsaaaaaaaaaaaaaaaaaaaaaaaaaaaa

Explanation:

7 0
3 years ago
Explain the theory of plate tectonics and how they changed Earth's surface over time. Include the role of plate tectonics
My name is Ann [436]

Answer:

The theory of plate tectonics states that the Earth's solid outer crust, the lithosphere, is separated into plates that move over the asthenosphere, the molten upper portion of the mantle. Oceanic and continental plates come together, spread apart, and interact at boundaries all over the planet.

4 0
2 years ago
How much bacteria would exist at the end of a 24 hour period if you started at 1 and doubled every 15 minutes
Mnenie [13.5K]
Convert 24 hours into minutes
24 hours = 1440 minutes
Divide 1440 by 15
There’s 96 divisions
Now take 2^96 power
You will have 7.9 x 10^28 bacteria
5 0
3 years ago
Biology is a static science that is never changing or evolving
mihalych1998 [28]
That statement is false.

Biology study everything about living organism. As living organisms keep evolving, the things that we studied at biology will always changing and will never be static

hope this helps
8 0
3 years ago
Which of the following severe weather events is NOT likely to result in flooding?
Lelu [443]
Hurricane, typhoon,
6 0
3 years ago
Other questions:
  • Three loci are found to be located (linked) on Chromosome 2 in fruit flies. At locus 1, wild is dominant over tall (a). For locu
    5·1 answer
  • What is ne function of the smooth endoplasmic reticulum?
    13·1 answer
  • What conclusion about flowers is supported by the evidence in the cladogram? *
    12·1 answer
  • HIRRY
    5·1 answer
  • The chemical reaction in which glucose is converted to ATP in the mitochondria ​
    15·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Which relational dialectic is at work for the following scenario
    13·1 answer
  • Can i get example of ecosystems that I can investigate during winter & how to do so?
    8·1 answer
  • How much does a 5'9" woman weigh
    9·2 answers
  • How does the amount of day light affect the number of eggs laid by a chicken?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!