Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
Due to the large number of fossils being discovered at that time Darwin proposed that species change over long periods of time.
Explanation:
The theory of Darwin was that the species change in accordance to their environment, thus they develop advantageous traits so that they can be more competitive.
Answer:
Yes the cell will re-aggregate
Explanation:
Cells from tissue B are isolated and dissociated, then treated with the antibodies raised against cell type A membrane proteins. Will cells from tissue By aggregate.
Aggregation permits a cell-cell contact present in a tissue, this enhances the function and behavior if the cells.
Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.
Answer:
P waves,
Explanation:
There are two types of body waves: P-waves travel fastest and through solids, liquids, and gases; S-waves only travel through solids. Surface waves are the slowest, but they do the most damage in an earthquake (that's a start)
