1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ch4aika [34]
3 years ago
15

Plants are susceptible to bacterial infections, which can damage their structure or even kill them. Which of the following would

be the best antibiotic to treat a plant that is infected with bacteria?
Biology
1 answer:
Lapatulllka [165]3 years ago
7 0

Complete Question:

Plants are susceptible to bacterial infections, which can damage their structure or even kill them. Which of the following would be the best antibiotic to treat a plant that is infected with bacteria?

A) a drug that interferes with mitochondria function

B) a drug that disrupts cell wall structure and function

C) a drug that destroys the central vacuole

D) a drug that blocks gene expression in circular chromosomes

Answer: Option D (a drug that blocks gene expression in circular chromosomes.

Explanation: Circular chromosomes are chromosomes found in prokaryotes (including bacteria). Gene expression process in the cell is powered by the barterium’s circular chromosomes.

However, gene expression refers to process in which the information present in the gene (DNA and RNA) are used to produce proteins for specific cell functions. Part of the functions enables the cell to respond to change in it’s fluctuating environment. Which in turn, enable the inner environment fairly stable.

Some proteins are synthesized to regulate the proper functioning of other organelles of the cell including the cell wall, vacuole and etc.

Thus, introduction of antibiotics that disrupts the gene expression in the circular chromosomes will be the best way to eliminate the bacteria affecting the plants. Since, if there's no gene expression in action, no protein is produced for proper organelles and the whole cell functioning. Hence, the bacteria are rendered dead.

You might be interested in
Is a part of all organic compounds which make up living things?
telo118 [61]
The answer will be an ecosytem
3 0
3 years ago
Metabolism can be defined as the ________.
ankoles [38]
D. sum of all chemical reactions in an organism
5 0
2 years ago
______ are also known as “local hormones”
AlexFokin [52]

Answer:

Autacoids or "autocoids" are biological factors (molecules) which act like local hormones

6 0
3 years ago
Read 2 more answers
The mutation in which a chromosome carries repetitive sets for a gene is called a
BigorU [14]
A duplication is a mutation where the chromosome carries repetitive sets for a gene.
6 0
3 years ago
What is the volume of 2.7 moles of N2 at STP?​
AnnyKZ [126]

Answer:

60.48L

Explanation:

By definition, at STP (Standard Temperature and Pressure), any gas takes up a volume of 22.4L.

Consequently, because the ideal gas law (PV=nRT) states that the number of moles is directly proportional to the volume of the gas, 2.7M of N2 takes up a volume of:

2.7*22.4L

=60.48L

3 0
2 years ago
Other questions:
  • Looking at the chemical reaction provided here, propose a different method that could be used to measure amylase activity: Starc
    15·1 answer
  • Fill in the blanks to complete the passage. Geologists can use ________ waves to learn about Earth’s interior. P waves travel fa
    13·2 answers
  • Write down 3 ways pollination can occur without animals
    14·2 answers
  • Prokaryotes contain all of the following except _____.
    12·2 answers
  • Which food component is indigestible by the body?
    6·2 answers
  • Chloe is developing a model of photosynthesis. The first part of the model is shown below.
    5·2 answers
  • Which of the following is a part of the male gamete formation, but not in female gamete formation?
    9·2 answers
  • You cant find a nucleus in a bacteria you see under a microscope why
    14·1 answer
  • All of the following are functions of proteins except?
    10·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!