Answer:
FfPp
Explanation:
If we take the two traits to be separate alleles, we can make flowers F (F is dominant; f is recessive) and pollen as P (P is dominant; p is recessive). So a pea plant with white flowers (recessive) and long pollen (dominant) will have the genotype ffPp or ffPP (because one dominant allele will express a dominant phenotype).
For this question, we will assume that the wild type (red flowers and long pollen) is homozygous, meaning it contains two dominant alleles.
If the wild type (FFPP) is crossed with the plant with white flowers and short pollen (ffpp), we can make a table illustrating the crosses. However, because there is only one possible gamete that each parent can form (FP and fp), we can assume that the F1 progeny will have identical genotypes, which can be expressed as FfPp (because combining the gamete from the wild type and the other parent can only give one phenotype).
It's where two or more cells involves.
like magnets
Chbsbyb yny y ck gmg
Gmmgmc xj
Db my. Bc c
Cnnxmy
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
