1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nady [450]
3 years ago
14

Witch of following organelles convert solar energy into glucose and oxygen

Biology
1 answer:
tresset_1 [31]3 years ago
6 0
The answer is: Chloroplasts.
You might be interested in
Write a paragraph in the space below, explaining in your own words how electromagnetic radiation is created by the Sun. Describe
aalyn [17]

Answer:

The sun gets its energy from the process of nuclear fusion. This process occurs in the sun's core or interior, where temperature and pressure are extremely high. During most of the sun's life, energy comes from the fusion of hydrogen nuclei

Explanation:

3 0
2 years ago
Read 2 more answers
Please help i am giving brainliest
yan [13]

Answer:

a.Brain

Explanation:

Hypothalamus: The hypothalamus  is in the lower central part of the brain. It links the endocrine system and nervous system. Nerve cells in the hypothalamus make chemicals that control the release of hormones secreted from the pituitary gland.

3 0
3 years ago
Read 2 more answers
After clara learned that penguins are birds that cannot fly, she had to modify her existing concept of birds. this best illustra
OLEGan [10]
Answer:  "accommodation".
________________________________
8 0
2 years ago
Read 2 more answers
To investigate whether roots exert a pushing force strong enough to cause water to move up the stems plants,my question is state
SIZIF [17.4K]
1. The plant should not have leaves. To prevent transpiration from taking place

2. Plant should be well watered. Plants need water

3. Put some Vaseline to seal open gaps. This prevents water evaporation

Unfortunately I don't have the 4th one :/
4 0
3 years ago
What genetic factor contributes to developing heart disease?
Advocard [28]

Answer: one of your relatives or family memember having it

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • The _________ is the main artery that receives blood from the left ventricle of the heart distributes it to the body.
    15·1 answer
  • A plant leaf shows veins arising from a central thick vein to form a complicated network. Which type of venation does this plant
    12·2 answers
  • HELP! ASAP! Please UNDERLINE the dependent variable and BOLD the independent variable FOR EACH.
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The following table describes several molecules and their functions. The molecules all belong to the same class.
    6·2 answers
  • Can someone please help me ASAP
    5·1 answer
  • In snapdragons, red flowers and white flowers are inherited in a pattern of incomplete dominance.
    13·1 answer
  • Which are examples of negative feedback? Select three options. a child whose thymus gland is building an immune system that gets
    16·2 answers
  • Need help please with this
    7·1 answer
  • 1. A(n) blankis a stretch of dna consisting of an operator, a promoter, and genes for a related set of proteins, usually making
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!