1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lisa [10]
3 years ago
12

in this diagram, the moon is directly in front of the earth. Where would most likely happen if the moon was not directly in fron

t of the earth?
Biology
2 answers:
koban [17]3 years ago
4 0

Answer:

<u>Moon and Earth:</u><em>" The moon is an astronomical entity which is smaller in size, as compared to Earth's body, and revolves around the Earth."</em>

  • It is revolving around the Earth from billions of years on a very specific path, which is tilted at 5 degrees to the plane of earth's orbit around the sun.
  • When the Sun, moon, and the earth are completed aligned at the same angle, having the 0° angle between them, while the moon completes all it phases is called as lunar cycle.

Explanation:

<u>Effect of Moon Position around the Earth- </u>

  • It is said that for all this time the astronomical body which is considered the most important to drive life on earth is moon.Now, the moon is considered to be responsible for the high and low tides on the surface of earth.
  • And the biological environment is sustained on earth, due to moon's position around the earth in a specific orientation, which is maintaining the life on earth, and keeping the atmosphere and biosphere in stable level.
  • And if moon displaces from its position then obviously high tides will vanquish, resulting in low tides in the ocean. Along with which the stability in the biosphere and atmosphere will decrease with time.
kenny6666 [7]3 years ago
3 0

The Moon's Two Shadows. An eclipse of the Sun (or solar eclipse) can only occur at New Moon when the Moon passes between Earth and Sun. If the Moon's shadow happens to fall upon Earth's surface at that time, we see some portion of the Sun's disk covered or 'eclipsed' by the Moon.

HOPE THIS HELPED!!!! XD

You might be interested in
A substance that releases hydrogen ions in water is a base.<br> a. True<br> b. False
Vlada [557]
It is true, it does release hydrogen ions in a water base.
8 0
3 years ago
Read 2 more answers
Downward slippage of the humeral head when relaxed may indicate an injury to the ____________ muscle.
natta225 [31]

Please refer the attachment  for the correct answer

3 0
3 years ago
Read 2 more answers
What are the three general properties of stem cells? Check all that apply.
Ainat [17]
They are capable of dividing and renewing for Long periods of time They are unspecialized and they can give rise to speacialized cell types
5 0
3 years ago
Read 2 more answers
A fat molecule belongs to which category of organic molecules
lbvjy [14]
Lipids since they are triglycerides.<span>
</span>
7 0
3 years ago
Identify the evolutionary forces that can cause allele frequencies to change from one generation to the next.Check all that appl
Lana71 [14]

Answer:

B. Mutation; C. Random genetic drift; D. Migration; F. Natural selection

Explanation:

B. Mutation:  Mutations resulting from substitution, addition or deletions of a nucleotide in a sequence can alter the gene. This can be carried over a population and may be have deleterious effects or increase fitness in a gene.

C. Random genetic drift: It is a change in allele frequency that occurs by chance, usually in a small population and is carried over generations.

D. Migration: Involves the flow of a gene in or out of a population, and this modifies the allele frequency.

F. Natural selection: When fitness-promoting alleles are favored and carried over to the next generation.

3 0
3 years ago
Other questions:
  • The water temperature process in which is forced into the air is called
    14·1 answer
  • Mineral nutrients from the soil move into roots by
    9·1 answer
  • What are protist considered animal like or fungus like or plantlike
    9·1 answer
  • Joe Tourist and his family leave for Dallas , a distance of 177 miles. They arrive in Dallas 12 hours later because they stopped
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Large rocks are transported by _____.<br><br> saltation<br> traction<br> suspension<br> floating
    12·1 answer
  • In everyday life, a theory is an educated guess.In science a theory is
    10·2 answers
  • The mammoth, which was very hairy, and the elephant, are both thought to have evolved from a scantily haired ancestor. Explain,
    7·1 answer
  • This is how it works. You need 5 paragraphs. Introduction, how they work, benefits for both.
    12·1 answer
  • Arianna recent traveled abroad where she enjoyed eating food from different countries and learning about different cultures
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!