1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
9966 [12]
3 years ago
11

What albedo has to do with arctic sea Ice melt in you own explanation ​

Biology
1 answer:
avanturin [10]3 years ago
3 0

Answer:

If there is decrease in albedo in the arctic sea, It could heat up the sea then it'd lead up to methane to escape from ice crystals.

Explanation:

So basically, loss of albedo in the arctic will make warming faster that'd lead to ice crystals leaking methane, from what I've heard.

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
When heat is added to a substance describe how the molecules are affected enter your answer in the space provided
Y_Kistochka [10]

molecules will gain energy, causing them to move faster and spread further from each other

4 0
3 years ago
Which statement best describes the movement of heat energy in the atmosphere?
Len [333]

Answer:

<h2>During radiation, waves transfer heat and light energy which affects the air temperature.</h2>

Explanation:

<h2>Hopes this helps. Mark as brainlest plz!</h2>
6 0
3 years ago
Complete the following statement.
lakkis [162]

Answer:

Quasar is the answer

Explanation:

Quasar have been shown to travel from 300% of the speed of light, to 8 times the speed of light according to red shift data.

5 0
3 years ago
I will mark u brainliest correct answer only !
vladimir1956 [14]

Answer:

C

Explanation:

3 0
3 years ago
Other questions:
  • One reason that regulation of gene expression is important is that it saves energy and materials from being used when they are n
    5·1 answer
  • Which event does not need to take place before meiosis can begin
    9·1 answer
  • The nurse is caring for a client before, during, and immediately after surgery. which type of care is provided to the client?
    15·1 answer
  • Which kind of farming is associated with less soil erosion?
    7·2 answers
  • Identify one general effect of overuse of an environmental resource.
    5·1 answer
  • Other than clouds, how else do we use condensation?
    10·1 answer
  • The _________ is the actual genes that an organism has. For example: HH, Hh or hh.
    5·1 answer
  • Which of the following will be the most similar?
    8·2 answers
  • Describe the ways mutations can affect DNA and chromosomes.​
    7·1 answer
  • Two types of bone markings are:
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!