1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis23 [38]
3 years ago
13

What provides evidence for plate tectonics?

Biology
2 answers:
adell [148]3 years ago
7 0
Some of the best evidence for the theory of plate tectonic are earthquakes, plants that are in different continents across the ocean,or mountains. Some of the best evidence for the theory of plate tectonic are earthquakes, plants that are in different continents across the ocean,or mountains.
finlep [7]3 years ago
5 0
One of the best evidence is earthquakes as well as mountain building, the way mountain building is made is when two plate collide and both start pushing upwards against the land to make famous mountains such as mount Everest but also keep in mind it take many years for it to form! Hope this helps you out on your quiz! :)
You might be interested in
What soil composition would be best for availability of nutrients, water, and root development? A. equal amounts of sand, clay,
Travka [436]

Soil composition would be best for availability of nutrients, water, and root development higher proportion of humus; lower amounts of clay and sand

Compared to the lower soil layers, the topsoil or surface soil often includes more organic matter and air but less clay. The topsoil typically has the highest concentration of plant roots and is more fertile than the other layers.

  • Nutrient management includes managing the composition of the soil. Minerals, organic material, water, and air are the fundamental elements of soil. Typically, 45% of the soil is made up of minerals. 5% organic material 20–30% water and 20–30% air are used. At best, these percentages are merely generalizations.
  • Numerous nutrients are found in soil, which are obtained from dead plants and animals. The plants eat these nutrients as nourishment. So soil contributes to the growth of plants by giving them sustenance in the form of nutrients.

To learn more about Soil composition it visit : brainly.com/question/15015701

#SPJ4

3 0
1 year ago
I attached the problem below.
kkurt [141]
I would think the answer is B.) All species share a common ancestor and that change occurs through time.

- I've recently went over this again with my teacher. I hope this helps! (:
5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
7. Which molecule is light energy temporarily stored in before being used to make glucose?
BlackZzzverrR [31]

Answer:

The Calvin cycle uses CO2 and the energy temporarily stored in ATP and NADPH to make the sugar glucose. Photosynthesis is a two stage process. As is depicted here, the energy from sunlight is needed to start photosynthesis. The initial stage is called the light reactions as they occur only in the presence of light

4 0
3 years ago
If T=20% What is A, G & C
fiasKO [112]

Answer:

i dont understand

Explanation:

free points on me who want em

3 0
2 years ago
Other questions:
  • When a molecule of double-stranded DNA undergoes replication, it results in
    8·2 answers
  • What is the difference between osmosis and diffusion? A. Diffusion uses energy, but osmosis does not. B. Osmosis is movement of
    12·2 answers
  • Mitochondria, the organelles involved in cellular respiration, can also generate chemicals called reactive oxygen species (ROSs)
    13·1 answer
  • How do humans obtain the nitrogen they use in their bodies
    5·2 answers
  • What does endocrine system regulate? A) blood flow B) voluntary muscle impulses C) involuntary muscle contractions D) hormone an
    7·1 answer
  • Josiah says this is a phylogenetic tree of the dinosaurs. maleek says it is a cladogram of the dinosaurs. who is correct?
    6·1 answer
  • If your temporal lobe was damaged, what might happen to you?
    10·1 answer
  • Which correctly describes a genetic trait that is sex linked in humans
    7·1 answer
  • How many chromosomes make us human?how many chromosomes do we get from each parents
    10·2 answers
  • The correct way to calculate population size is by dividing the total population by the land area.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!