1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetradugi [14.3K]
3 years ago
10

Who creates best management practices? Why?

Biology
1 answer:
goldenfox [79]3 years ago
6 0

Answer:

Best management practices (BMPs) are methods that have been determined to be the most effective and practical means of preventing or reducing non-point source pollution to help achieve water quality goals. BMPS include both measures to prevent pollution and measures to mitigate pollution

You might be interested in
What evidence do you consider to be the most significant and convincing support for human evolution? Today there is one species
UNO [17]

Answer:

The history of the human evolution can be studied by the fossil and DNA evidence. The similarities and advancement in certain characters has revealed the human evolution.

Different evidences like change in the diet, locomotion, brain size, walking ability as compared with the present species and species appeared 6 million years ago. The human genetics evidence and different paintings explain the culture of earlier homo species.The H. sapiens species has highly advance character that help them to survive than any other hominid species. The neanderthals extinction might occur due to their aggressive behavior, low social ability and their large cranial size.

6 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
List two examples of how cells' shapes are suited to their functions?
sukhopar [10]

Answer:

<u>Red blood cell in humans -</u> it has no nucleus. Hence it offers the cell to carry more haemoglobin.

- they are disc shaped allowing them to pass through narrow capillaries.

<u>Root hair cells in plants-</u> they have a large cytoplasm which enables them to take water from the soil.

<u>White Blood Cells in humans -</u> they have lobed nucleus and so can change their shape to pass through narrow capillaries.

  • <em><u>HOPE IT HELPS...</u></em>

5 0
2 years ago
Which macromolecule forms a double layer as the primary structure of cell membranes?
OlgaM077 [116]
Answer;
Phospholipid.

Phospholipid forms a double layer as the primary structure of cell membranes.

Explanation; 
Cell membranes contains of lipids (phospholipids and cholesterol), proteins and carbohydrates groups that are attached to some of the lipids and proteins. 
Phospholipids are composed of a polar head and non-polar (hydrophobic) tail. They line up such that the heads and the tail groups are side by side to form a single layer due to the interactions between the head groups and the tail groups. Two of these layers line up with the hydrophobic tail groups facing each other to prevent the hydrophobic groups away from the polar head groups of other phospholipids and from the water in the surrounding environment. 
6 0
3 years ago
Read 2 more answers
Which of these planets atmospheres would be most able to support a colony of humans
Pachacha [2.7K]
None...........................probably mars 

7 0
3 years ago
Other questions:
  • Compare the two pictures above. These show the beginning of mitosis and meiosis. How are they different?
    10·2 answers
  • The characteristics describe organisms found in the domain
    6·2 answers
  • Which example of artificial selection is caused indirectly by human activity?
    8·1 answer
  • HELP ASAP PLEASEEEEEEEEEE!!!!!!???????
    9·2 answers
  • If the Earth were closer to the Sun, the intense heat might evaporate the oceans and create an atmosphere similar to the atmosph
    12·1 answer
  • Help lolllllllll HAHAHHAHAHAHAHHAHAHAH
    11·1 answer
  • An individual sustains injuries to only the ascending tracts of the spinal cord. Will this person experience deficits in movemen
    8·2 answers
  • Amelia puts some ice cubes in a cup of water at room temperature. Which statement describes the heat flow in this situation?
    10·2 answers
  • How do the respiratory system, circulatory system, and nervous system maintain homeostasis while you are playing outside on a su
    15·2 answers
  • The __________ is the fatty substance that insulates and protects the axon. A. Cell body B. Axon terminal C. Neural receptor D.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!