Answer:
The history of the human evolution can be studied by the fossil and DNA evidence. The similarities and advancement in certain characters has revealed the human evolution.
Different evidences like change in the diet, locomotion, brain size, walking ability as compared with the present species and species appeared 6 million years ago. The human genetics evidence and different paintings explain the culture of earlier homo species.The H. sapiens species has highly advance character that help them to survive than any other hominid species. The neanderthals extinction might occur due to their aggressive behavior, low social ability and their large cranial size.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
<u>Red blood cell in humans -</u> it has no nucleus. Hence it offers the cell to carry more haemoglobin.
- they are disc shaped allowing them to pass through narrow capillaries.
<u>Root hair cells in plants-</u> they have a large cytoplasm which enables them to take water from the soil.
<u>White Blood Cells in humans -</u> they have lobed nucleus and so can change their shape to pass through narrow capillaries.
- <em><u>HOPE IT HELPS...</u></em>
Answer;
Phospholipid.
Phospholipid forms a double layer as the primary structure of cell membranes.
Explanation;
Cell membranes contains of lipids (phospholipids and cholesterol), proteins and carbohydrates groups that are attached to some of the lipids and proteins.
Phospholipids are composed of a polar head and non-polar (hydrophobic) tail. They line up such that the heads and the tail groups are side by side to form a single layer due to the interactions between the head groups and the tail groups. Two of these layers line up with the hydrophobic tail groups facing each other to prevent the hydrophobic groups away from the polar head groups of other phospholipids and from the water in the surrounding environment.
None...........................probably mars