1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nlexa [21]
3 years ago
13

What is the name given to cell division im eukaryotes

Biology
2 answers:
sashaice [31]3 years ago
7 0
The name given to cell division in eukaryotes is mitosis and cytokenisis.
gizmo_the_mogwai [7]3 years ago
5 0
Eukaryotic cells divide via mitosis - that is to say, a cell divides to create 2 genetically identical cells.
You might be interested in
Which of the following individuals would MOST likely have the lowest basal metabolic rate?
shepuryov [24]

Answer:

The preferable option will be - B.

B. A 28-year-old anorexic female

Explanation:

  • Anorexia is simply known as an eating disorder.
  • Losing weight, fear of gaining weight, and a strong desire to be thin are the most popular symptoms.
  • Some genetic problems, some social connection factors from the glamour world, athletics, etc. But the exact accurate cause is still unknown.
  • Some complications are seen such as osteoporosis, infertility, heart damage, and menopause.

The BMI categories are -

  • Mild disease - greater than 17,
  • Moderate disease - 16 to 17,
  • Severe disease - 15 to 16,
  • Extreme disease - less than 15.

   

5 0
3 years ago
MARKING PEOPLE AS BRAINLIST ⚠️⚠️⚠️<br><br> Give three pros and cons of fire suppression
IrinaK [193]
Cons:
It kills animals
It destroys land and trees
It ruins animals homes

Pros
It clears up lane so we can build
Some rare animals need fire to reduce overhanging plants to live ( it’s called a karner blue Caterpillar btw)
And fire is a natural phenomenon that nature has evolved with
4 0
3 years ago
In a short, detailed paragraph, please answer the following.
katovenus [111]

Answer:

Ans - 1 Photosynthesis begins with the light reactions. It is during these reactions that the energy from sunlight is absorbed by the pigment chlorophyll in the thylakoid membranes of the chloroplast.

Ans-2 The dark reactions of photosynthesis occur in the stroma of the chloroplast where they utilize the products of the light reaction. In the dark reaction, plants use carbon dioxide with ATP and NADPH from the light reactions to produce glucose.

Ans-3 The main factors affecting rate of photosynthesis are light intensity, carbon dioxide concentration and temperature.

5 0
3 years ago
Place the following in order from smallest to largest.
ivolga24 [154]
Cells, tissues, organ, and body system.
7 0
4 years ago
Read 2 more answers
Which body system includes vitamin D production and protection against pathogens and excess water loss?
Fantom [35]

Answer:

A. Integumentary system

Explanation:

The integumentary system consists of the skin,hair and nail. This system consists of the largest organ in the body. The skin helps in protection against pathogens by shielding the internal body system from external objects.

The skin also helps in Vitamin D production through sunlight.

It also helps to prevent dehydration through regulation of water loss.

7 0
3 years ago
Other questions:
  • PLEASE HELP ME!! THIS IS AN EMERGENCY!!
    5·1 answer
  • Ayúdenme correctamente
    10·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Name the most suitable apparatus for measuring exactly 1centimeter of hydrochloric acid​
    5·2 answers
  • The system that removes waste in the blood from the body
    8·1 answer
  • Most of the energy resources used to generate electricity are renewable true or false
    6·1 answer
  • Wild hogs introduced to Texas from Europe became feral after the
    8·1 answer
  • Below are statements that describe either traits that follow the typical pattern of Mendelian inheritance or sex-linked inherita
    12·1 answer
  • PLS ANSWER IM SO CONFUSED.................Organisms other than humans are_____ to certain climates and would not survive in othe
    15·1 answer
  • 1. What class of biological molecules does sugars belong to?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!