1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VikaD [51]
3 years ago
14

Which function does a phytoplankton have in ocean ecosystems? A. producer B. consumer C. scavenger D. decomposer

Biology
2 answers:
Solnce55 [7]3 years ago
5 0
I believe a producer. 
pav-90 [236]3 years ago
4 0

Answer: A. Producer

Explanation:

Since the seas on Earth are so tremendous, the atmosphere shifts drastically. Warm tropical waters along the bank of the equator feel about like shower water. These spots are home to unimaginable biodiversity. However, the solidifying waters of the Arctic have their very own biological system as well, regardless of the temperature. Indeed, even the bone-squashing profundities of the remote ocean are home to stunning kinds of life.  

Coral reefs live in the shallow, warm waters close to the bank of the equator. The producers in all seas, including the coral reefs, are fundamentally algae and phytoplankton, minuscule photosynthetic living beings that produce nourishment from water and daylight.

You might be interested in
Structure within a cell that direct with type of protein make
kodGreya [7K]
Ribosomes make proteins in the cell
8 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
If fruit flies are still used today what can happen?
ICE Princess25 [194]

Answer:

You may not think that Fruit Flies pose a health risk but they are insects and all insects pose a health risk if they hang around long enough.

Explanation:

8 0
3 years ago
Read 2 more answers
g A ________________ gradient is directly used to provide the energy for ATP synthesis in the mitochondria.
adelina 88 [10]

Answer:

Elerochemical gradient

Explanation:This coccus during  the  process of  chemiosmosis in oxidative phosphorylation during cellular respiration. It is the  electrochemical gradient that provides the energy  needed by ATPase Synthase for the phosphorylation of ADP tp ATP, necessary for ATP production

The electochemical gradient is due to  gradient produced from the pumping of protons by the proton  motive force(PMF) into the intrammenbrane space. from the matrix.The accumulation leads the the production of electrochemical gradients because the Protons diffuse across  from higher gradient in the intramembrsne space into the lower concentration gradient the matrix.Therefore,energy is produced  as the diffusion takes place.

The ETC, is the source of generation of PMF, which pumps protons across into the intramembrane, for the electrochemical gradients productions

8 0
4 years ago
Use the following information to answer the following question.
Sonbull [250]

Answer: If this population were in equilibrium and if the sickle-cell allele is recessive, the proportion of the population susceptible to sickle-cell anemia under typical conditions should be 0.20

Explanation: Hardy-Weinberg law provides an equation to relate genotype frequencies and allele frequencies in a randomly mating population. The equation is;

p² + 2pq + q² = 1

For 2 alleles such as A and a, where

p² = homozygous dominant

q² = homozygous recessive and

2pq = heterozygous

From the question, it is said that the sickle-cell allele (SS) constitutes 20% (that is, 20/100) of the hemoglobin alleles in the human gene pool and it is also said to be the homozygous recessive allele.

Therefore, q² = 20/100 = 0.20

4 0
3 years ago
Other questions:
  • Which scientist established the law of octaves?
    13·1 answer
  •  Which of the following does not lay amniotic eggs? 
    14·1 answer
  • Which include the male and female sex cells?
    8·1 answer
  • Which of the following statements about the action potentials in contractile myocardial cells (cardiac muscle) is INCORRECT? Com
    5·1 answer
  • If a person's cerebellum were damaged in an accident, you would expect that person to have problems with:
    14·1 answer
  • Which of the following cyclin molecules is essential to activate pre-replication complexes (pre-RCs)?
    13·2 answers
  • what would happen if homogenisation and pasteurisation steps are omitted during the production of yoghurt
    13·1 answer
  • Palmas is closer to the equator than Neuquén. Which location has a warmer air temperature and why? *
    10·2 answers
  • Which of the
    8·1 answer
  • 1: Energy is conserved in ecosystems. true/false
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!