1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mars2501 [29]
4 years ago
10

What is the name used to describe organisms that exist between the living and non living​

Biology
1 answer:
Nikitich [7]4 years ago
5 0
The living parts of an ecosystem, called biotic factors, are all the organisms that live in the area. The nonliving parts, called abiotic factors, are the nonliving things in the area. All the living things together in an ecosystem form a community.
You might be interested in
Which theme of biology explain the modification of an organization of an part to adapt to its habitat
Alona [7]
A organism adapts to its environment by using stuff like a long layer of blubber on walruses and polar bears in the artic
5 0
3 years ago
What micromolecule is produced during photosynthesis for plant food?
Marina86 [1]
<h3><u>Answer;</u></h3>

Carbohydrate

<h3><u>Explanation;</u></h3>
  • Carbohydrate is the macromolecule produced during photosynthesis for plant food. Carbohydrate is among the four major macromolecules, others being, nucleic acid, lipids, and proteins.
  • During photosynthesis energy from the sun, together with water and carbon dioxide are used to make nutrients or organic compounds such as simple sugars like glucose.
  • By using the energy from the sunlight and absorbing the water molecules from the soil, the plant produces glucose molecules. The glucose is a carbohydrate.
7 0
3 years ago
Read 2 more answers
The probability of a ___________ channel being open is controlled by the membrane potential.
Anna11 [10]

Answer:

(b) Voltage gated

Explanation:

The cell membrane acts as a barrier that separates two aqueous media of different composition, the extracellular and the intracellular, regulating its composition. Most of the liposoluble drugs and solutes, when not ionized, directly cross the cell membrane through a passive diffusion process, which facilitates the passage of the medium where it is more concentrated to the one that is more diluted. The difference in concentration between the two media is called the concentration gradient, and diffusion will continue until this gradient is eliminated. According to Fick's law, the speed of this process will be much faster the higher the concentration gradient and the liposolubility of the molecule and the smaller its size.

More hydrophilic molecules, such as ions, are immiscible in membrane lipids and pass through specific specific transport mechanisms. In some cases, ions pass through hydrophilic pores called ion channels, and in others a favor of their concentration gradient is transported by binding to the transporter or transporter proteins. Both transport systems are passive and therefore do not consume energy. The great advantage is that the ion channels allow the flow of ions through a much higher speed than that of any other biological system. The flow of ions through each channel can be measured as an electric current, which is capable of producing rapid changes in membrane potential.

8 0
3 years ago
What occurs during cell differentiation?
Archy [21]

Answer: Zygote cells turn into adult STEM cells divide and create differentiated daughter cells.

Explanation: All DNA is in all cells, but different cells are specialized to preform different functions. They still contain all of the DNA, but they only use a small portion of the DNA. This occurs during a process called Gene Expression. Gene expression is the specific combination of genes that are turned on or off (expressed or repressed), and this is what dictates how a cell functions

5 0
3 years ago
A student is investigating temperature changes at a nature preserve on a hot, clear day. Each hour, the student takes two temper
Nataly [62]

A. Air over the lake will reach its highest temperature later in the day and will stay warm longer than air over the ground.

Explanation:

The most likely observation the student will record is that the air over the lake will reach its highest temperature later in the day and will stay warm longer than air over the ground.

This phenomenon between the differences in land and water temperature causes land sea breeze to occur.

  • Water has a very high specific heat capacity.
  • This implies it takes more heat to cause a monumental increase in its temperature.
  • It is expected that the student will observe that the air over the lake body will reach its highest temperature later in the day. It would have gotten heated with time.

A body such as water in a lake with a high specific heat capacity stays warm for a longer period of time compared to other substances.

Metals do not have high specific heat capacity and would not stay warm for long. They quickly lose heat.

learn more:

Specific heat capacity brainly.com/question/7210400

#learnwithBrainly

3 0
3 years ago
Other questions:
  • PLEASE HELP, MARK BRAINLIEST
    14·2 answers
  • In a plant, red flower color is incompletely dominant over yellow. What will the distribution of flowers in the F2 hybrids be if
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • In an adult human, does cell division rarely occurs in nerve cells?
    13·2 answers
  • What is the function of naturally occurring restriction enzymes in bacterial cells?
    13·1 answer
  • Which of the following can cause a mutation in a gene?
    8·1 answer
  • According to cell theory, which are made of cells? check all that apply
    12·1 answer
  • 3. Recent years there has been an increase in the number of shark attacks along the Florida beaches. Tahir has been hired by the
    9·2 answers
  • What is the difference between the independent variable and the dependent variable? ( NO LINKS PLEASE)
    5·2 answers
  • Which of these body systems transports glucose and other substances in the blood
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!