1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iragen [17]
2 years ago
10

Pl any onee here joinmgz-omtm-vbu​

Biology
1 answer:
Liono4ka [1.6K]2 years ago
8 0

Answer:

i can

Explanation:

You might be interested in
[Intro: Chief Keef]
Igoryamba

Answer:

who is joe?

Explanation:

joe nuts

6 0
3 years ago
Read 2 more answers
Which of the following best explains why cells remove waste
Pachacha [2.7K]

Answer: they have to maintain homeostasis, so they remove waste to do so..

5 0
3 years ago
Which of the following is abiotic?<br> an earthworm<br> a mosquito<br> a flood<br> none of these
MakcuM [25]

Answer:

probably flood

:))

Explanation:

hehehe

7 0
2 years ago
Which describes the most direct function of the nostrils?
3241004551 [841]

Answer: they allow air to enter lungs and also permits air into the body

Explanation:

6 0
3 years ago
Read 2 more answers
To learn how Earth's atmosphere has changed over time, sientists study air bubbles
nirvana33 [79]

Answer:

The answer is D!!!

3 0
3 years ago
Other questions:
  • How much of Haiti’s forests have been cut down
    13·2 answers
  • what cycle do the light independed reaction use to tuen carbon dioxude into glucose, A. Calvin cycle, B. Krebs cycle, C. Gylcoly
    8·2 answers
  • Has a tadpole evolved if it changes into a frog
    15·2 answers
  • 0cm3 of acid were mixed with 60cm3 of alkali in an insulated container. The average temperature of the two solutions before they
    5·1 answer
  • A circular opening cut into the skull to reveal brain tissue and decrease intracranial pressure is called a
    12·1 answer
  • A scientist crossed a pea plant with a green pod and a pea plant with a yellow pod. The scientist collected 100 seeds from the c
    8·1 answer
  • A 34-year-old male experienced an abduction injury to his right arm. he is found in extreme pain, holding his injured arm in a f
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Changes in temperature, pressure, and _____ affect gases more than solids or liquids.
    8·1 answer
  • The photo shows a male peacock displaying his beautiful
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!