1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vladimir79 [104]
3 years ago
12

During metaphase sister chromatids come to the middle of the cell true or false

Biology
1 answer:
AnnZ [28]3 years ago
8 0
Q. During metaphase sister chromatids come to the middle of the cell...

A. False

Why?

Well, during metaphase sister chromatids separate and move to the opposite poles of the cell not towards the middle of it.
You might be interested in
Disruption of adenylyl cyclase type 5, a novel target for obesity, diabetes and diabetic cardiomyopathy
ikadub [295]
1234567890-=097654321
5 0
3 years ago
How does the denaturing of an enzyme affect the enzyme activity
Anit [1.1K]
It will completely stop the enzyme's activity when the denaturization is complete.
5 0
3 years ago
How does human activity affect earths freash water resources
Nikolay [14]

Answer:

People throw their trash and pollution into the fresh water and make it not as fresh or safe to the animals as much as it could be.

Explanation:

3 0
3 years ago
Which of these groups contains a single -celled organisms?
brilliants [131]

Answer:

   Escherichia coli.

   Diatoms.

   Protozoa.

   Protista.

   Streptococcus.

   Pneumococci.

   Dinoflagellates.

Explanation:

3 0
3 years ago
Some can force their stomachs outside their mouths to digest prey
ddd [48]

Answer:

A. Sea stars

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • How have anthropologists attempted to address the negative effects of massive cultural change imposed on less powerful groups by
    12·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • which of the following is not a characteristic of life? a. maintains homeostasis b. composed of cells c. composed of atoms d. ca
    11·1 answer
  • In April 2009, a new strain of influenza A emerged. This strain, known as the swine flu, caused at least 95 deaths in over 40 di
    13·2 answers
  • For lunch, you eat French fries at a new restaurant. Later that day you get the stomach flu and are vomiting all night. The next
    10·2 answers
  • A gene pool consists of all the genes within a
    11·2 answers
  • if you see a tall, rock feature that looks like a jagged, rectangular block sticking out of the ground, youre probably observing
    8·1 answer
  • some people wrongly compare the cells inside the body with bricks in a wall.actually three are scores of difference between the
    13·1 answer
  • All plants are unicellular organisms
    13·2 answers
  • According to the Punnett square, offspring from these two parents have a ____________ chance of inheriting one B allele and one
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!