1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Makovka662 [10]
3 years ago
8

Name one advantage of election microscopes

Biology
1 answer:
Firlakuza [10]3 years ago
8 0

Your able to see things u cant with the naked eye.

You might be interested in
Students were given a list of seven elements and asked to identify the four elements that are most abundant in biomolecules. Whi
velikii [3]

Answer:

A is the correct answer bud

4 0
3 years ago
DNA is always present in lysosomes. a. TRUE b. FALSE​
lara [203]

Answer:

False

Explanation:

Lysosomes are membrane-bound vesicles that recycle waste products. They contain digestive enzymes that breakdown waste and recycle the components in the cell. For example, old cellular organelles, viruses or bacteria, large biomolecules.

They might sometimes contain DNA, but not always.

3 0
3 years ago
Where sperm cells mature and are stored
Stolb23 [73]
Sperm cells are stored an matured in the Epididymis
6 0
3 years ago
What is a fossil and how can they be used to help unveil earth’s history
Firdavs [7]

Answer:

fossils are ancient bones or plants fossilized into rocks such as dinosaur bones(fossils) and they help unveil earths history by telling us more about them and what they might have looked like and big or small they were everything we know we know because of fossils

Explanation:

If brainiest is earned its greatly Appreciated

5 0
4 years ago
Please give a small paragraph quickly summarizing the what, when and how of each of the following techniques: PCR, DNA gel elect
Anuta_ua [19.1K]

Answer:

All are used to resolve questions in molecular and biochemistry/biotechnology

Explanation:

PCR: resolution of an amplicong on agarose gel to chech size after thermocycling

DNA gel electrophoresis,

Recombinant DNA, A DNA fragment that it attached to another such as a reporter, commonly used is GFP attached to protein of interest to track movement

Cloning, Duplicate an amplicon, insert into a vector, transform this vector into a bacteria that is designed to make multiple copies of itself

Northern blots, Method used to detect different sizes RNA from a mixture of other products

Southern blots, method used to detect different sizes of DNA similar to the idea of a Northern Blot

Western blots, Resolution of protein sizes by running the protein through an acrylamide gel in an ionic buffer

Antibody production (polyclonal and monoclonal),  Generating an antigen against a protein using different parts of the same protein (polyclonal) or only a specific sequence of the protein not a variety of antigens from the full length (monoclonal)

ELISA, enzyme-linked immunosorbent assay is used to check the presence of a protein

FRET, Transmission energy of one molecule to another, it is usually included in the detection of colors in fluorescence microscopy

FRAP, this method will is called Fluorescence recovery after photobleaching, a microscospy measurement

FACS, this is a type of cell sorting Fluorescence-activated cell sorting

Fractionation by centrifugation, Lysis of agents such as cells that can be lysed by spinning in a centrifuge

Chromatography, separation of chemical thru a media by colors

Fluorescence microscopy,  use of fluorophore to detect specimen under a microscope a specific wavelength

Coomassie staining,  procedure used to stain an acrylamide gel or membrane to show protein presence

Silver staining, use of a silver colloid to change the way proteins are seen on a Western blot or under a microscope

His tag, a string of histidine residues attached to a protein for easy manipulation/detection

GST tag, Glutathione S-transferases is a group of proteins used in protein purification an option other than His tag

Confocal microscopy,

FISH, The generation of a nucleotide probe used in DNA sequence detection in histology

PCR, Polymerized chain reaction used to amplify selected region of DNA

DNA library, the collection of gDNA of a specific specie or tissue

cDNA library, collection of the coding sequence of a organism/tissue

Microarrays, the platform used to detect thousands of gene sequences at once

Sanger sequencing, Method used to derrive DNA sequence developed by Frederick Sanger by incorporating a single nucleotide at a time

GFP, Green fluorescent protein, a reporter protein used in recombination protein creation

Bright field microscopy, microscopy that uses light or natural light to detect samples

DIC microscopy, Differential interference contrast is used to detect and enhance the different levels of contrast of a specimen

Phase contrast microscopy, Microscopy technique used to detect the different states of matter of a specimen

Fluorescence microscopy, use of fluorophore attached to sample for investigation

Transmission electron microscopy, uses beams of electrons to pass through a sample to then create an image

Scanning electron microscopy,  the surface of a sample is scanned with a beam of electrons to generate an image

X ray crystallography, determining a structure of a protein my using an x-ray technique

2D PAGE electrophoresis,  separation of proteins by two phases sizes and charges

NMR,  Nuclear magnetic resonance, spinning of all the nuclei and measurement of the energy that it gives off.

Mass spectrometry Protein sequencing technique based on weight

4 0
3 years ago
Other questions:
  • When light energy excites electrons in photosystem II, where do the electrons to replace them come from?. . A.ATP. B.photosystem
    14·1 answer
  • Ruby's father has curly hair and her mother has straight hair. Ruby, however, has wavy hair. What could be the reason for this?
    10·1 answer
  • Which two species are more closely related: Ursus maritimus, ursus americanus or bufo americanus
    5·2 answers
  • An allergic reaction to certain types of natural, unprocessed foods, such as peanuts, is caused by
    7·1 answer
  • Which term describes the fusion of cytoplasm from two individuals?
    11·1 answer
  • How is sound detected by the barin
    13·1 answer
  • Physical activity not related to a persons job is defined as?
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is the domain containing all organisms with eukaryotic cells
    11·1 answer
  • During the loading of tbp, what event displaces the binding of tafs 11 and 13 from one of the stirrups of tbp?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!