Answer:
C.emigration is the answer......
Answer:
The human genome is the complete set of nucleic acid sequences for humans, encoded as DNA within the 23 chromosome pairs in cell nuclei and in a small DNA molecule found within individual mitochondria. These are usually treated separately as the nuclear genome, and the mitochondrial genome.
Answer:
The answer is the purpose of the purchase.
Explanation:
A marketing company is a business record and leading standard proposal published by a customer to a merchant, showing varieties, sizes, and allowed charges for commodities or stints. It is employed to constrain the acquiring of commodities and militarizes from obvious suppliers. In extension, the consumer should forever acutely and explicitly state their requests to the agent so there is no trouble when the buying order is initiated.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
go to mindbodygreen and there are the benfits
