1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Digiron [165]
3 years ago
6

What information is found in the dietary guidelines for Americans?

Health
1 answer:
taurus [48]3 years ago
4 0
Look up Health.gov. The dietary guidelines are explained further on this website. "The guidelines provide help for healthy Americans ages 2 years and over about food choices that promote health and prevent disease."

https://health.gov/dietaryguidelines/dga95/9DIETGUI.HTM
You might be interested in
You are sleeping at the station while on shift. The tones go off loudly and lights instantly come on. You jump out of bed and qu
Oksana_A [137]

Answer:

The correct answer is Alarm Reaction or Alarm Stage.

Explanation:

Alarm stage is also called as a fight and flight stage. During this stage, our brain sends signals to all the parts of the body and informs the body that some emergency situation has arised.

Due to this emergency situation, our heart starts beating faster which in turn sends more blood to the various parts of the body, adrenals glands enhances the release of stress hormone called cortisol and our body receives a kick of adrenaline rush which in turn boosts energy.

5 0
3 years ago
What information is required to find VO2 max using the one-mile walk test?
zalisa [80]

Answer:

ihgt

Explanation:

helloo gngyt

7 0
3 years ago
Please help 14 points! thanks to all!
Andreas93 [3]
Blood location b it going into the heart and carries o2 with it from the lungs
6 0
3 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
4 years ago
Health is wealth justify the statement with suitable example​
Mariana [72]
Health is wealthy is true said . if your health is good then you avail do anything which you like . If your health is not good , then you want to do anything but can't due to your health.

Hope this helps good luck :)
4 0
3 years ago
Other questions:
  • How does understanding terminology’s structure and construction help you to understand medical terms?
    12·1 answer
  • During glycogenesis, our bodies store glucose as glycogen in the A. stomach and liver. B. liver and muscles. C. muscles and kidn
    12·2 answers
  • Which choice correctly defines a component of the nervous system?
    14·1 answer
  • Blood pressure measurements on adult males 30-39 years of age were obtained in a survey of a representative sample of Twin Citie
    14·1 answer
  • Why is it important for a new patient to complete a Patient Registration form?
    7·1 answer
  • ——— and ——— are skills the goalie uses to send the ball back into play
    15·1 answer
  • Explain a low context communication style
    12·1 answer
  • The ball can only be passes which ways?
    14·2 answers
  • How to calculate total carbs​
    9·1 answer
  • On a mixed diet of carbohydrate, protein, and fat, what percent of the energy expenditure at rest is derived from fat?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!