1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alina1380 [7]
3 years ago
12

An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​

Health
1 answer:
s2008m [1.1K]3 years ago
5 0

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

You might be interested in
I need help on this question;
m_a_m_a [10]

⊂      The         Awnser     is        D                    ⊃  

5 0
4 years ago
The Affordable Care Act was passed in 2010.
BigorU [14]
The Patient Protection and Affordable Care Act<span>, often shortened to the </span>Affordable Care Act<span> (</span>ACA<span>) or nicknamed Obamacare, is a </span>United States<span> federal statute </span>enacted<span> by the 111th </span>United States<span> Congress and signed into law by President Barack Obama on March 23, 2010. The term "Obamacare" was first used by opponents </span>
3 0
4 years ago
What is a risk assessment?
lawyer [7]

Answer:

Broadly speaking, a risk assessment is the combined effort of: identifying and analyzing potential events that may negatively impact individuals, assets, and/or the environment; and making judgments "on the tolerability of the risk on the basis of a risk analysis" while considering influencing factors.

hope this helps

have a good day :)

Explanation:

3 0
3 years ago
Which of the following events typically comes first in the process of puberty in a female? a) the first period b) breast growth
Alex73 [517]

Answer:

Girls usually begin puberty between the ages of 8 and 13 years old. The earliest sign of puberty in most girls is the development of breast "buds," nickel-sized bumps under the nipple.

4 0
3 years ago
Which of these is the most likely outcome of bulimia nervous if the illness is left untreated
poizon [28]
Death is a likely outcome to untreated bulimia. 
3 0
3 years ago
Other questions:
  • What is behavior therapy
    15·1 answer
  • What professionals would a rehabilitation center hire
    7·2 answers
  • The average adolescent should consume no more than __ grams of fat perday
    15·2 answers
  • According to the video, what are some factors that make this job stressful? Check all that apply. new technologies creative deci
    10·2 answers
  • What are the fundamental structural and functional units of all living things? atoms organs molecules cells
    9·2 answers
  • Hello I was in health class but my teacher told us to search the web to find out why our bottoms blow out gas.
    7·2 answers
  • Tissues damaged by myocardial infarction are replaced by fibrous connective tissue. True or False
    11·2 answers
  • Many factors affect health and wellness. Match each description to its type.
    12·1 answer
  • Fontanelles are used to guide the baby’s head during delivery. true or false?
    12·1 answer
  • What is your stand regarding pre-marital sex and early pregnancy?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!