1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alina1380 [7]
3 years ago
12

An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​

Health
1 answer:
s2008m [1.1K]3 years ago
5 0

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

You might be interested in
How does Exercising help someone fight stress
anyanavicka [17]
Helps keep the stress out of your mind and exercising can help reduce stress when your putting your mind and body to work
6 0
4 years ago
Read 2 more answers
You cannot change a decision in the STRONG process after you have made it.
Mice21 [21]

The given statement is False.

You cannot change a decision in the STRONG process after you have made it. This statement is false.

Explanation:

In the STRONG process of decision making, there are four models. These models are used for decision making. These four models are as follows:

  • Position Evaluation
  • Calculation
  • Tactical Check
  • Blunder Check

In the last part of the model, which is the Blunder Check, the whole decision is reviewed and checked for any types of errors. If any error or blunder is detected in the process, the whole decision is changed and is checked again for the desired results. So the given statement is False, which says that you cannot change a decision in the STRONG process.

Learn more about STRONG process of Decision Making at:

brainly.com/question/1113966

#LearnWithBrainly

7 0
3 years ago
Define blood pressure. How do you calculate it? What does systolic reading mean? What does dystolic reading mean?​
MAXImum [283]

Answer:

When your doctor takes your blood pressure, it's expressed as a measurement with two numbers, with one number on top "systolic" and one on the bottom "diastolic", like a fraction. For example, 120/80 mm Hg. The top number refers to the amount of pressure in your arteries during the contraction of your heart muscle.

Explanation:

4 0
3 years ago
Read 2 more answers
Which of these is the most effective way to rest after exercise?
Black_prince [1.1K]

Answer:

the most effective way is 1. Take a full day off between workout sessions

Explanation:

BUT they are all good ways to recover. so ima list in the order of best to worst

- Take a full day off between workout sessions

- Alternate daily activities to work other muscles

- Increase your potassium and sodium intake

 - Get a massage to treat muscle soreness

7 0
3 years ago
Read 2 more answers
When filling out a doctor's visit form.... What important information do you need?
kati45 [8]
Drivers license/Id, Insurance card, Social security number and sometimes other health records
5 0
3 years ago
Other questions:
  • your self-esteem is an important part of your emotional and mental health. Name and describe two ways you can build your self-es
    12·2 answers
  • Twelve-year-old Ella will be in middle school next year. She will be going through many developmental changes in the next severa
    14·1 answer
  • Stan works on an assembly line. What effective and appropriate approach would he be wise to use when coping with minor frustrati
    8·2 answers
  • Where would the following activity BEST fit on the physical activity pyramid?
    7·2 answers
  • Why are proteins important
    12·2 answers
  • “Your skin isn't paper, don't cut it Your face isn't a mask, don't hide it Your size isn't a book, don't judge it Your life isn'
    9·1 answer
  • A personality trait is
    12·2 answers
  • Some dementias, including _____, begin with impaired motor control.
    14·1 answer
  • I have molars with pointy cusps and a simple digestive system. what type of diet do i have?
    10·1 answer
  • Share your thoughts and habits when it comes to the nutrient called fat.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!