1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
HACTEHA [7]
4 years ago
12

SOMEONE PLEASE HELP ME ASAP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Mathematics
1 answer:
Semenov [28]4 years ago
8 0

Answer:

U must I wait I don’t no

Step-by-step explanation:

You might be interested in
a store received 500 containers of milk to be sold by Febuary 1. Each container the store sold $0.83 and sold for $1.67. The sto
FrozenT [24]
$409.80.

The amount of net profit the store makes on each container is given by 1.67-0.83 (the amount it is sold for subtracted by the amount it costs the store), which is $0.84 per container.  They sell 470 containers, so the net profit at this point is 470(0.84) = $394.80.

However, since the distributor is giving the store a $0.50 refund on all every container under 500 that the store sells, the store gets additional money back:

500-470 = 30 containers not sold
30(0.50) = 15

So the total profit is $394.80 + 15 = $409.80.
6 0
3 years ago
Given the following​ function, find f(−5), f(0), and f(4). f(x)=x2+5
bulgar [2K]

Answer:

30, 5 , 21

Step-by-step explanation:

substitute the values of x into f(x) , then

f(- 5) = (- 5)² + 5 = 25 + 5 = 30

f(0) = 0² + 5 = 0 + 5 = 5

f(4) = 4² + 5 = 16 + 5 = 21

6 0
2 years ago
I am stuck on how to do 10 percent of $55.86
faust18 [17]

Answer:

read step by step

Step-by-step explanation:

.10×55.86 = 5.58

then subtract $5.58 from your total .

and that will give you the answer

8 0
3 years ago
How is a triangle alike to a square
dimaraw [331]
They both have an area and are both 2d shapes and just shapes in general
8 0
3 years ago
1/3 kilogram to 2/3 of a foot
HACTEHA [7]

Answer: idk dont know need more info

Step-by-step explanation:

5 0
3 years ago
Other questions:
  • PLEASE HELP ME ON THIS!!
    10·1 answer
  • A teacher needs to find out how many seventh graders will be going on a field trip. Which best describes the population that the
    10·2 answers
  • If two lines have the same slope and y-intercept, what is true of the lines? A. The lines are perpendicular. B. The lines inters
    7·2 answers
  • If g(x)= 4, then g(5x) = ?
    8·1 answer
  • What are the discontinuity and zero of the function f(x) = quantity x squared plus 5 x plus 4 end quantity over quantity x plus
    14·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • A study found that 12% of dog owners brush their dog’s teeth. Of 493 dog owners, about how many would be expected to brush their
    13·1 answer
  • Shaniqua brings home $250 per week working 25 hours. She is able to save $30 of her earnings each week.
    7·2 answers
  • Solve the system. explain what method you chose<br> 5x+2y=17 <br> x-2y=8
    7·1 answer
  • HELPPPPPPPP ASAP !!!!!!!!!!!!!!!
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!