Ask question

Ask question

All categories

4 years ago

14

A patient has a very high concentration of insulin receptors on cells that require insulin for glucose to enter. How should insu

lin dosages be adjusted for this patient to have blood glucose levels within the normal range?

1 answer:

Wewaii [24]4 years ago

5 0

Insulin dosage should be decreased because the drug will exert it’s actions at lower concentrations.

You might be interested in

AUUUAACUGUUCUGUCUAGAG

Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0

3 years ago

Describe the structure and function of a root hair cell

Nadya [2.5K]

Root hair cells absorb minerals and water from the soil.

The water absorbed by the root hair cells passes through the plant in xylem tubes, to then reach the leaves. The energy from the sun is then used to convert water(H2O) into hydrogen (H) and oxygen(O2).

I hope this helps

4 0

3 years ago

A jet airplane takes off and flies through the troposphere toward the

kenny6666 [7]

Answer:

because it is leaving the earth and going into space

Explanation:

6 0

3 years ago

Read 2 more answers

How do CAM plants differ from C3 and C4

algol13

Answer:

C3 photosynthesis produces a three-carbon compound via the Calvin cycle while C4 photosynthesis makes an intermediate four-carbon compound that splits into a three-carbon compound for the Calvin cycle. Plants that use CAM photosynthesis gather sunlight during the day and fix carbon dioxide molecules at night.

Explanation:

3 0

4 years ago

A protein that acts as a hormone is _____. 1. collagen 2.methionine 3. pepsin 4. insulin

galben [10]

Answer:

The correct answer is 4. insulin

Explanation:

Proteins are made up of amino acids which are joined together by peptide bond. Insulin is a peptide hormone which is made amino acids therefore it is also a protein. An insulin molecule is made up of 51 amino acid residues and 5808 Da is its molecular weight.

The insulin hormone is released by the beta cell of the pancreas. It is released when the level of glucose in the blood increased from the normal blood glucose level.

It helps in conversion of glucose into glycogen and its storage in muscles and liver. So by doing this, it decrease the level of glucose in the blood. Therefore the right answer is 4.

8 0

3 years ago