1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio039 [100]
3 years ago
5

Stoplights have a taste that is preferred by gobblers. Suppose a mutation occurred in the gene for taste. The mutation resulted

in offspring with a bitter taste that repels the gobblers. What would you expect to happen to that mutation over time?
Biology
1 answer:
Mila [183]3 years ago
5 0
The mutation would die down. (What is a gobbler?)
You might be interested in
The concentration of solute outside of the cell are_____than the inside of the cell
tatiyna

Answer:

If you place an animal or a plant cell in a hypertonic solution, the cell shrinks, because it loses water ( water moves from a higher concentration inside the cell to a lower concentration outside ). A single animal cell ( like a red blood cell) placed in a hypotonic solution will fill up with water and then burst.

4 0
2 years ago
Here is an important list of "nevers" to follow when using a compound light microscope in the lab. 1. Never swing the microscope
ivolga24 [154]

Answer:

D. "always" cover the microscope when not in use.

Explanation:

when you are finished using a light microscope or any microscope in general you always need to put the cover back on it. Mostly, to protect it from any harmful bacteria, light etc. and to keep it clean and, from collecting dust.

7 0
2 years ago
The scientists mapping the SNPs in the human genome noticed that groups of SNPs tended to be inherited together, in blocks known
Over [174]

Answer:

SNPs have shown that only 0.1 % of DNA sequences are different in the human genome between different individuals, thereby all the inherited phenotypic variation observed in our species is associated with only 0.1 % of differences at the genome level  

Explanation:

Haplotypes are block-like sequences of DNA that are inherited together due to low recombination rates. Moreover, single-nucleotide polymorphism (SNP) mapping is a very useful methodology used to map the site of SNP mutations (i.e., SNP variants). In this regard, it has been observed that there are approximately 10 million common SNPs in the human genome. These SNPs contribute to the wide range of phenotypic variation observed in human populations for different traits (e.g., eye color, hair, weight, height, etc). Moreover, researchers have determined that SNPs can be clustered into haplotypes, thereby haplotypes can be accurately sampled by as few as approx. 300,000 selected SNPs, which are sufficient to represent all of the genetic variation across different human genomes.

5 0
3 years ago
I need help is it A B C or D
Neko [114]
I think it is C but i am not completely positive.<span />
7 0
2 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • What type of frog has translucent skin
    14·2 answers
  • generally speaking, how does the age of geologic structures in florida compare with the age of those in colorado?
    12·2 answers
  • Flow Chart What happens to food and energy when it enters the cell? Finish the description for each organelle. Step 1: Mitochond
    11·1 answer
  • Plz can somebody help me I will give brain
    5·1 answer
  • Which of the following changes to the crust can happen from the movement of Earth's plates? (multiple choice) A.glaciers carve h
    7·1 answer
  • The Earth takes a year to orbit around the Sun. What about the Moon?
    5·2 answers
  • How much of the parent DNA molecule makes up one daughter DNA molecule ?
    14·1 answer
  • Rising water vapor that meets cold air and turns into water
    12·1 answer
  • A set of genetic material on chromosome that control a particular trait is referred to​
    12·1 answer
  • A. Compare and contrast the blood glucose concentrations of the two people.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!