1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margaret [11]
3 years ago
10

A DNA sequence encoding a five-amino acid polypeptide is given below:

Biology
1 answer:
Blizzard [7]3 years ago
3 0

Answer:

Explanation:

The sequence recording the five amino acid is 5' CTA-ATC-AGA-CCG-TAC-CAT 3'

The template strand is the strand from which the mRNA is transcribed

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding stranger has the same sequence as the mRNA except the replacement of T with U in the mRNA

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. The shine delgarno region is GGAGGA

e. This region functions as the mRNA binding site to the small subunit of the ribosome in the process of translation.

You might be interested in
Macromolecules: What are the building blocks of life worksheet
Orlov [11]

Answer:

Find it somewheer

Explanation:

4 0
2 years ago
A solute uses a protein channel to cross into or out of the cell. What
Natalija [7]
D, active transport because that protein uses atp to cross channels and active transportation is the only form of movement that’s used atp to move
6 0
3 years ago
What is synthesized from the DNA template? This is used to assemble ______ into ______.
Vladimir79 [104]
Answer:
            The right option for blanks is mRNA, amino acids and polypeptide chain (protein).

Reason:
             During protein synthesis first of all mRNA formation occurs from DNA template. Then mRNA come out from nucleus into cytoplasm and bind with ribosome, where tRNA come and binds to mRNA codon with the help of anticodons. and add amino acids. In this way a chain of polypeptide is formed.
8 0
3 years ago
Point A is the same distance from the epicenter as point B. Using what you know about the movement of waves, how would you
never [62]

A.  The waves would be exactly the same at points A and B.

Explanation:

The seismic waves at both point A and B would be exactly the same at the two points.

Seismic waves are elastic waves that spreads out concentrically in all directions from their source.

  • Both S and P waves are body waves that moves within the earth.
  • In a seismic station, the p-waves or primary waves arrives first before the s-waves or secondary waves.
  • At any point equidistant from the epicenter, baring any geologic differences in the subsurface, the waves would be exactly the same at all points.

Learn more:

Locating the position of an earthquake brainly.com/question/11292835

#learnwithBrainly

5 0
3 years ago
What is complete function of digestive system
weqwewe [10]

Answer:

the function of the digestive system is digestion and absorption. digestion is the breakdown of food into small molecules, which are then absorbed into the body. the digestive system is divided into two major parts.

7 0
3 years ago
Other questions:
  • Any help??? It would be appreciated!
    6·1 answer
  • Plants cant move so how do they mate
    10·1 answer
  • In the space provided below draw electron dot diagram's for the following atoms: nitrogen (N), hydrogen (H), oxygen (O), and car
    15·1 answer
  • Which of the molecules shown in question 5 has an asymmetric carbon? Which carbon is asymmetric?
    8·1 answer
  • Acetylcholinesterase is an enzyme that catalyzes the breakdown of the neurotransmitter acetylcholine. Which of the following exp
    13·2 answers
  • What happens to proteins as they pass through the golgi apparatus?
    9·2 answers
  • Dinosaurs emerged during what time period? A. Paleozoic Era B. Mesozoic Era C. Proterozoic Eon D. Cenozoic Era
    10·1 answer
  • Which of these is a physical change  in matter
    13·1 answer
  • What is the basic scheme of the nervous system
    5·1 answer
  • consider a stable frog population living at carrying capacity in a pond. an average female produces 6,000 eggs during her lifeti
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!