1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margaret [11]
4 years ago
10

A DNA sequence encoding a five-amino acid polypeptide is given below:

Biology
1 answer:
Blizzard [7]4 years ago
3 0

Answer:

Explanation:

The sequence recording the five amino acid is 5' CTA-ATC-AGA-CCG-TAC-CAT 3'

The template strand is the strand from which the mRNA is transcribed

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding stranger has the same sequence as the mRNA except the replacement of T with U in the mRNA

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. The shine delgarno region is GGAGGA

e. This region functions as the mRNA binding site to the small subunit of the ribosome in the process of translation.

You might be interested in
what's porosity ? A. The ease with which water is able to flow from one pore to another in rock B. The ability of water to trick
topjm [15]

The measure of how much water can be stored in geological materials is referred to as porosity. The correct option is C.

<h3>What are geological materials?</h3>

A geological material is a natural material extracted from the Earth in the form of rock or sediment, such as rocks, clays, sands, limestone, and other industrial minerals.

The percentage of void space in a rock is defined as porosity. It is defined as the ratio of the void or pore space volume to the total volume.

Thus, the correct option is C.

For more details regarding porosity, visit:

brainly.com/question/2593663

#SPJ1

7 0
2 years ago
The seeds of ___________ are protected in some type of fruit.<br>A.angiosperms<br>B.gymnosperms
Natalka [10]

Answer:

a

Explanation:

Because it mom said so.

5 0
3 years ago
What is the effect of uneven heating of the earth's surface on the environment ​
zhannawk [14.2K]

When people speak about convection, they are usually referring to the uneven heating that occurs on the surface of the earth.

Consequences of an inconsistent heating system:

Because of the disparity in temperature distribution, certain areas of the environment are hotter than others, and there are also shifts in volume and tension as a result.

It generates updrafts, which in turn may lead to thunderstorms and other types of severe weather.

The Earth has moved slightly on its axis.

Because the sun's rays are directed directly at the equator, the temperature there is higher than in other parts of the planet.

As you approach farther north or further south of the equator, they drop down in an incline or at an angle.

Because of this, the temperature of the earth is uneven, which in turn shapes the wind and the flow of the sea and makes it possible for life to exist.

To know more about thunderstorms click on the below link:

brainly.com/question/6838263

#SPJ4

3 0
2 years ago
4. Does this reaction absorb or release<br> energy? How do you know?
Vesna [10]
What reaction ?
I know endothermic absorbs energy while exothermic releases energy.
Or you could be talking about photosynthesis or cellular respiration.
8 0
3 years ago
Sent a picture of the question
Step2247 [10]

The third one, hope this helped.

7 0
3 years ago
Other questions:
  • What are the three divisions (Eras) of the Phanerozoic Eon?
    7·1 answer
  • What is the displacement for a driver who travels 10 km to get to a point that is 4 km from his starting point? 10 km 6 km 4 km
    11·1 answer
  • Can you guys help me how to answer this questions?
    13·1 answer
  • BRAINLIESTTT ASAP!!!!<br><br> Explain the domain system. How has it changed over the years?
    13·1 answer
  • A young couple went to see a genetic counselor because each had a sibling affected with cystic fibrosis. (Cystic fibrosis is a r
    7·1 answer
  • NEED ASAP! How does the amount of food in a meal effect the time it takes to digest
    7·1 answer
  • Explain about Photosynthesis . ?​
    15·2 answers
  • How many chromosomes do whales have
    13·1 answer
  • Drag the tiles to the correct boxes to complete the pairs.
    10·1 answer
  • What does an Epidemiologist study?<br> A. Diseases<br> B. Plants<br> C. The Epidermis<br> D. Insects
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!