1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ozzi
4 years ago
11

Environmental factors can influence natural selection because they can increase or decrease

Biology
2 answers:
DIA [1.3K]4 years ago
8 0

Answer:

The answer is the 4th option.

Explanation:

I did the test. :3

mariarad [96]4 years ago
7 0
The amount of genetic variation in a population
You might be interested in
From the types of light that reach Earth's surface, which do you think could be causing skin cancer?
Ratling [72]
UV light caused cancer because it damages the DNA in our cells. Changing the characteristic of a cell can cause cancer
5 0
3 years ago
Which one of the following is a difference between a normal cell and a cancer cell?
MAVERICK [17]
What are the following?

6 0
3 years ago
Read 2 more answers
Which characterization accurately describes BOTH regular fossils and index fossils?
kompoz [17]

Answer:

D

Explanation:

Fossils tell us where they came from.

Have a great day

7 0
3 years ago
How do electrons gain energy in photosystem 1?
expeople1 [14]

Answer: they absorb photons from sunlight.

Explanation:

3 0
3 years ago
Read 2 more answers
What is an autotroph and what is a heterotroph
Usimov [2.4K]

Autographs are organisms that make their own food/energy. The only example I can think of (and the only one I think exists) is plants. They make glucose from the sun and other stuff

Heterotrophs are organisms that needs to get its energy from other sources. You and me are heterotrophs (well unless you are a plant lol). We have to eat food to get energy to survive.

Hope this helped!!!

3 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Does water move in or out of cell during hypotonic and hypertonic solutions?
    8·2 answers
  • The minimum amount of stimulus for an action potential to occur is
    15·1 answer
  • Select the correct location
    9·1 answer
  • How do scientists know that dark matter and dark energy exist even if we can not see them
    11·1 answer
  • Is the is the movement of planets predictable
    5·1 answer
  • Summarize what you have learned in Lesson 3.1 by answering the focus question: "What is the pattern of Earth's average temperatu
    8·1 answer
  • Using "i" statements: O A. Always makes your point to the other person OB. Starts arguments OC. Helps eliminate name-calling OD
    14·1 answer
  • Explain how a scientist can determine when a particular species of dinosaur lived on Earth.
    15·1 answer
  • The pH of a solution is a measure of ____________________ ions and ____________________ ions in that solution.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!