1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Slav-nsk [51]
3 years ago
13

What causes blood pressure?

Biology
2 answers:
Alborosie3 years ago
7 0
<h2>B. Stress that exercises puts on heart muscles</h2><h3>High Blood Pressure (HBP)</h3>

Higher blood pressures is caused by mental and physical stress that causes one to use their muscles and internal organs to a larger degree.

S_A_V [24]3 years ago
5 0

Answer:

I think A is the Answer.

Explanation:

You might be interested in
Excitatory postsynaptic potentials (EPSPs) produced nearly simultaneously by different synapses on the same postsynaptic neuron
lakkis [162]

Answer: summation

Explanation:

The process which determine if an action potential will be generated or not depends on the combined effects of the signal inputs from multiple sources of  synapse or from the repeated signals from the same synapse.  

If the input signals reach the threshold voltage, action potential will be generated. (all –or –none principle).Therefore, this  process is a determinant of  the likelihood of action potential generation  and it is called summation.

Summation is the ability to integrate multiple PSPs at multiple synapses.it is  the process that determine if an action potential will be generated by combined effects of inhibitory or excitatory  signals.

Based on the pathways and voulme of applied stimuli in the presynaptic neuron;

The signals can be temporal summation ( consecutive  signals  produced from the same  synapse)where action potential of high frequency in the PSN generated action potential in the post synaptic neuron, which summate with one another. Or Spatial where signals inputs are from multiple presynaptic cells.

3 0
3 years ago
When there is not enough carbon dioxide in a plant, a process called photorespiration may occur. This process uses the excess ox
sergiy2304 [10]

A prolonged period of photorespiration would affect a plant, giving a significant evolutionary advantage to plant species in dry climates.

<h3>What is the difference between photorespiration and respiration?</h3>

One of the basic differences between photorespiration and respiration concerns the effect of O2 on the two processes. Respiration saturates when O2 reaches approximately 2%, while photorespiration does not reach saturation in a pure O2 atmosphere.

<h3>Under what conditions does photorespiration occur?</h3>

Photorespiration is an expensive metabolic pathway that occurs when the Calvin Cycle enzyme rubisco acts on oxygen instead of carbon dioxide.

With this information, we can conclude that A prolonged period of photorespiration would affect a plant, giving a significant evolutionary advantage to plant species in dry climates.

Learn more about photorespiration in brainly.com/question/13433623

#SPJ1

5 0
1 year ago
Which of these is a pure substance? Question 3 options: a penny sugar ocean water iced tea
Sphinxa [80]
I believe the answer would be sugar

4 0
3 years ago
Photosynthesis and cellular respiration are said to form a continuous cycle because
Nata [24]
There are living organisms that do these processes alongside one another to sustain a balanced cycle.
4 0
3 years ago
What happens to oxygen levels when animals are introduced? Why?
Allushta [10]

Answer:

Higher oxygen levels means animals can grow larger and still maintain the supply of oxygen to their muscles. Falkowski and colleagues calculated fluctuations in the atmosphere's oxygen levels from cores of deep-sea rocks dating back 205 million years.

7 0
2 years ago
Other questions:
  • The pigment molecules responsible for photosynthesis are located in the
    12·1 answer
  • What karst feature represents the most advanced stage of erosion?
    10·1 answer
  • The structure that contains dna and controls the functions of the cells is called what
    15·2 answers
  • An insect eats a leaf. Explain how the insect depends on the sun for energy.
    12·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What one is true this is due soon.
    15·1 answer
  • Earthworms help farmers. Many farmers add them to their farmland because they help form rich soil to grow crops in.
    7·1 answer
  • The process of mitosis usually involves
    7·2 answers
  • Answer it plz <br> have a noce day ​
    9·2 answers
  • Why is global warming happening?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!