1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enyata [817]
3 years ago
5

In our lives, we rarely experience temperatures that are above 373 K (100 °C) or below 273 K (0 °C). Investigate how much diffus

ion rates differ between these two temperatures. Describe the results of your experiments below.
Biology
1 answer:
Serhud [2]3 years ago
3 0

Answer:

Explanation:

Activity B: Rates of diffusion

Introduction:The Diffusion       Gizmo allows you to manipulate five variables: the Wall, the number of x particles in region A, the number of y particles in region B, the temperature, and the Particle mass.

Question: How do factors other than temperature affect the rate of diffusion?

Get the Gizmo ready:

1.Choose a variable: Pick a variable to investigate. Which one did you choose? The wall.  

You might be interested in
A doctor is exploring some tissue with a blunt probe. She notices that the tissue is white and fatty and seems to be concentrate
MrMuchimi
The answer should be C if I'm not wrong
4 0
3 years ago
Read 2 more answers
Part 1: Why is Fresh Water in Short Supply?
shepuryov [24]

Part 1;

Because there is only limited amounts of fresh water on the Earth the rest is salt water; which humans can not survive on as the salt dehydrates our bodies instead of hydrates.

1) The more we try to get the the fresh water the more we will likely make more pollution.

2) The more we use the less there is.

3) Everything needs water.

Part 2; no idea I believe it is the ice caps, as it is fresh water in the ice caps and not a lot of humans up there to pollute the runoff.    

6 0
3 years ago
Explain how living things, such as people and trees, are different from nonliving things, such as rocks and the tent.
Alexus [3.1K]
LIVING THINGS BREATHE NON LIVING THINGS DOSENT
4 0
4 years ago
Read 2 more answers
What is the name of the membrane that lines the eyelids and covers the outer surface of the anterior sclera?
Mariulka [41]
Conjunctiva lines the eyelids and covers the anterior sclera
3 0
4 years ago
Which type of respirator delivers clean air to the breathing zone from a tank worn by the operator?
MissTica

An air-purifying respirator that employs a blower to pump air through filters or cartridges and into the user's breathing zone is known as a powered air-purifying respirator, or PAPR. In comparison to a powered or negative-pressure half mask, this generates a positive pressure inside the facepiece or hood, increasing protection.

<h3>What kind of respirator offers a separate source of clean air?</h3>

For entry into or exit from settings regarded as IDLH, Self-Contained Breathing Apparatus (SCBAs) are employed. They can be either open circuit or closed circuit and contain their own breathing air supply.

<h3>What 2 categories of respirators exist?</h3>

Air-purifying and supplied-air respirators are the two main categories of respirators. Respirators that purify the air remove airborne pollutants such particles, dangerous vapors, and/or gases. They are suitable for use in surroundings with low levels of pollution and in areas with enough oxygen.

<h3>When should you use an air purifying respirator?</h3>

a small, unproven area. a lack of oxygen in the atmosphere. Firefighting. Contaminants with a lower explosive limit (LEL—the concentration at which a gas or vapour could ignite) of at least 20%

learn more about air-purifying respirator here

brainly.com/question/3627134

#SPJ4

6 0
2 years ago
Other questions:
  • if a cell is isotonic in an 80% sucrose solution, how will the movement of water across the cell membrane affect the size of a c
    8·2 answers
  • The surface area for gas exchange in the lungs is provided by the
    12·1 answer
  • Which two ideas did Darwin use to explain evolution? modern synthesis and natural selection acquired traits and modern synthesis
    11·2 answers
  • What are the types of organs in the urinary system
    15·1 answer
  • ANSWER ASAP PLEASEEEEEE!!!!!! ILL GIVE 100 POINTS!!
    12·1 answer
  • Which of the following energy sources would most likely be used by a food producer who wants to follow the spirit of the farm to
    13·2 answers
  • What are the mode of feeding in different organism​
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The genotype dd is considered what? (2 words)​
    14·2 answers
  • Under anaerobic conditions, how do cells regenerate atp?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!