1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ruslelena [56]
4 years ago
13

How do water’s relative densities as a solid and a liquid differ from that of most other substances

Biology
2 answers:
Rasek [7]4 years ago
6 0
Solid water is less dense than liquid causing it to float while other substances are mainly more dense as solids.
tatiyna4 years ago
3 0

Answer:

The relative densities of the water as liquid and solid vary from the corresponding densities of the other substances. The density of the water's solid form is less in comparison to the density of water in its liquid form. While the majority of the other substances upsurges in density when they get solidify. This is why the ice floats on the surface of water's liquid form.

You might be interested in
What does the term "complementary" mean in base-pairing?
belka [17]

Answer:

From The School of Biomedical Sciences Wiki. Complementary base pairing is the phenomenon where in DNA guanine always hydrogen bonds to cytosine and adenine always binds to thymine. The bond between guanine and cytosine shares three hydrogen bonds compared to the A-T bond which always shares two hydrogen bonds.

7 0
3 years ago
Read 2 more answers
What helps oxygen to be observed rapidly into the blood in the lungs ​
julsineya [31]
The alveoli are lined with mucus and are surrounded by a network of blood capillaries. They have very thin walls for gases to be absorbed through. An individual air sac is called an alveolus. The layer of moisture in the alveoli allows gases to dissolve so that they can diffuse quickly.
6 0
3 years ago
Read 2 more answers
Areas of study that try to mimic science for cultural and commercial gain are called.
jekas [21]
<span>Areas of study that try to mimic science for cultural and commercial gain are called pseudoscience. 
Pseudo means fake, basically - it is not real science.
</span>
4 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
I need help with directional terms
sp2606 [1]

Answer:

Explanation:

calvical

6 0
3 years ago
Other questions:
  • How can i confess my love for senpai?
    8·1 answer
  • How does the body maintain homeostasis when its inner temperature becomes higher than the normal body temperature?
    12·2 answers
  • When an automatic battery is fully charged the sulfuric acid and water mixture will have a specific gravity of about
    11·1 answer
  • Read the paragraph.
    8·1 answer
  • Identify some geographical barriers that could separate populations.
    7·1 answer
  • Las bacterias están presentes en todos los alimentos ¿Qué ocurrirá con su metabolismo si refrigeramos o congelamos el alimento?
    8·1 answer
  • Honestly I barely use brainly anymore so I'm giving my 1532 points away.
    11·2 answers
  • How does natural selection explain why some organisms are more likely to survive and reproduce than other organisms?
    9·1 answer
  • Plz plz plz help Scientists rejected Wegener's theory because he could not _________________________.
    13·1 answer
  • 15. What are the similarities between the chemical structure and composition of proteins, carbohydrates, and lipids
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!