1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korvikt [17]
3 years ago
7

Michael,a 43-year-old was in a serious car accident. He has a rigid and tender left hypochondriac region. His blood pressure is

dropping and he is in pain. What might be the organ that is involved in this injury and what is the treatment necessary?
Biology
1 answer:
ValentinkaMS [17]3 years ago
3 0

Answer: spleen

Explanation:

Spleen, located just below the left rib cage which helps body to fight infection and filter out old blood cells from your bloodstream.

A severe blow to the abdomen may cause ruptured spleen during a sports mishap, a fistfight or a car crash. Signs and symptoms of spleen rupture include:

  • pain in the upper left abdomen
  • Tenderness in the upper left abdomen
  • Drop in blood pressure
  • Discomfort, lightheadedness or dizziness

The person will undergo immediate surgery on the abdomen to treat the ruptured spleen. The surgeon must cut the abdomen open and perform a procedure known as laparotomy.

You might be interested in
I am having trouble writing an itroduction to my lab report. For the lab we had to find an effective way to purify water. Any id
VLD [36.1K]
I HOPE THIS HELPS:

Many people don’t know how to get an effective way purify water but when you (tell them how to purify water) you will get an effective way to purify water. Stay tuned for all the details of how to purify water an effective way.

Can I get BRAINLIEST???
6 0
3 years ago
A human blood cell is placed in fresh water. As a result, water moves _____ the cell
Nuetrik [128]

Answer:

inside

Explanation:

osmosis is where water moves from high water conservation(outside of the cell) to a low water concentration(inside the cell) through the memebrane.

7 0
3 years ago
Read 2 more answers
Similar to most amoebozoans, the forams and the radiolarians also have pseudopods, as do some of the white blood cells of animal
sweet-ann [11.9K]
I believe it would be polyphyletic.
Polyphyletic groups are formed when two lineages convergently evolve similar character states. Organisms classified into the same polyphyletic group share phenetic homoplasies as opposed to homologies. The key difference between paraphyletic and polyphyletic groups is that paraphyletic contain their common ancestor, whereas polyphyletic groups do not. 

3 0
4 years ago
In a heat wave in June 2017, temperatures in some southwestern U.S. states reached
Step2247 [10]

Explanation:

cloth is a insulator so it stops heat from passing

4 0
3 years ago
What is the Venus Fly traps primary use
DerKrebs [107]
Kill bugs.......................

8 0
3 years ago
Read 2 more answers
Other questions:
  • what is the probability that two parents heterozygous for a particular trait will have a child that is homozygous recessive for
    5·1 answer
  • Birds and earthworms have a _____ that stores and softens food.
    10·2 answers
  • Why must zebras and wildebeests fill different niches on the open plains and woodlands of africa?
    6·1 answer
  • Pls i need help??!!!<br> write a sentence contrast evaporation and condensation.
    14·1 answer
  • Give an example of how biotic factors in an ecosystem can affect the abiotic factors
    10·1 answer
  • Imagine that you are a doctor. During your last shift, 20 babies were born. 10 had blue eyes, and 10 had brown eyes. 15 had roun
    15·1 answer
  • How does a convection current transport energy around the globe
    8·1 answer
  • What are some important interactions between substances in living things?
    11·1 answer
  • Which reaction has the lowest activation energy?
    14·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!