1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
8

How does a convection current transport energy around the globe

Biology
1 answer:
Helen [10]3 years ago
4 0
The ocean around the globe gets heated up due to the heat around the sun. This hot water is then passed through to the colder regions of the globe by the method of convection. This is a continuous process.
You might be interested in
Which layer is the youngest
mamaluj [8]
I think A is the youngest layer, because of the new sediments that fell upon the animal.
4 0
3 years ago
Read 2 more answers
Describe two ways that the carbohydrates are used in the ecosystem. (5 points
Nikolay [14]
Carbohydrates are made from the process of photosynthesis by green plants by use on energy from sunlight. They have various functions in the ecosystem by plants an animals. The two main function of carbohydrates are; carbohydrates as a source of energy for cellular activities. They are reserves and stored in form of starch in plants and inform of glycogen in animals. They also act as structural components in both plants and animals such as cellulose which is a components of plant cells.
5 0
3 years ago
Read 2 more answers
Which of these organic molecules functions to help speed up biological chemical reactions?
Vikki [24]

<span><span>B)
proteins

</span>Proteins are biological macromolecule and mostly composed of enzymes. In biochemical reactions, it is mostly triggered by enzymes. Enzymes are important components in the process that involves metabolism and digestive functions, further, most of these enzymes are proteins. </span><span>Proteins play a role in the physical make-up of a cell or acts as a cytoskeleton –maintains cell shape and figure. These proteins plays different roles and works with nucleic acids and other macromolecules in the cells including cell cycle, cell adhesion, immune response and cell indicators. <span>
</span></span>


7 0
3 years ago
Does one smile increase or decrease the chances of another
Lerok [7]

Answer:

increase the chances of another

3 0
3 years ago
Example of a real world problem when light bends when it passes throught
marshall27 [118]
The light ray bends toward the normal when entering water
4 0
3 years ago
Other questions:
  • A __________ is the basic unit of structure and function in living organisms.
    10·2 answers
  • I am a human cell with 92 chromosomes. I still have a nuclear membrane. Where am I in the
    15·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which virus has a structure that includes an outer lipid bilayer that is studded with proteins?
    7·2 answers
  • The diagram shows a certain kind of cell with all of its major parts labeled.
    9·2 answers
  • What are proteins composed of
    14·1 answer
  • Carbon dioxide is carried from the tissues to the lungs by a variety of mechanisms. Which of the following lists these mechanism
    7·1 answer
  • An example of a density dependent limiting factor is...
    7·1 answer
  • Contagious patients should enter the office from where
    9·1 answer
  • If the allele for an attached earlobe (e) is recessive to the allele for an unattached earlobe (E), what will be the relative fr
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!