Answer:
Answer is B. Carefully select the food s rich in nutrients but low in calories.
Explanation:
Myplate is a kind of chart showing the amount of food to put in plate in order to stay healthy.
In Margaret situation, the best thing for her is to start selecting food items that are low in calories, and at the same time rich in nutrients. Because if she does not put the nutrients level in consideration, her health will be severely affected.
Some of the examples of foods that are low in calories and rich in nutrients are fish, egg, oats,cabbage, popcorns, brocolli and fruits like apple and berries.
The natural rate of extinction as assumed by science is about 5 species per year. Currently scientists estimate we are losing species at 1000-10000 times that rate, with multiple species disappearing every day. A note on this idea is that the average extinction rate gives an unrealistic depiction of nature when we consider the catastrophic extinction events that ended the dinosaurs and shaped the ice age.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Explanation:deoxyribonucleic
They are water soluble and poured down the drain with the water.