1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mylen [45]
4 years ago
5

Olygenetic inheritance

Biology
1 answer:
Alik [6]4 years ago
6 0

The correct question is :  The given statement is True or False

While studying a sample for height differences, researchers observed that the height of the participants varied significantly regardless of whether the participants' parents were short or tall. This suggests that the physical characteristic of height is most likely an example of Polygenetic inheritance.

Answer: True

Explanation:

The poly genetic inheritance can be defined as the characters which is not only controlled by the single gene in the body it is controlled by the multiple genes of the body.

The genes are large in quantity but the effect is very small. There are many characters in the body which is polygenic in nature.

These are height of offspring, skin color of the offspring, eye color of the offspring, et cetera.

You might be interested in
A cylindrical tin full of engine oil has a diameter of 12cm and a height of 14cm.The oil is poured into a rectangular tin 16cm l
galben [10]

Answer:

Depth = 9 cm

Explanation:

First, calculate the volume of the cylindrical tin.

Mathematically, that would be the following:

V = \pi * r^{2} * h

Now, r = d/2 = 12/2 = 6 cm

h = 9 cm

Therefore, the volume will be:

V = 22/7 * 14 * 6^2 =1,584 cm^3

Now, to find the the depth of the tin, we have to realize that the content of the cylinder should fill in the tin to a particular height.

As we don't have the height of the tin so let's suppose it x, now it means that

l * b * h = 16 * 11 * x = 176x

Therefore, the depth would be:

176x = 1584

x = 1584 / 176 = <u>9 cm</u>

7 0
3 years ago
Which statement most correctly describes the primary role of a carrier protein?
vazorg [7]
 what statement? You didnt show any.
4 0
3 years ago
PLEASE HELP ASAP!!!
sweet [91]
3 is enzymes, 7 is c, 6 is either c or d, 5 is B, 4 is c 
7 0
3 years ago
The boater is wondering if it will rain. She uses a sling psychrometer ro measure the moisture content of the air relative to th
Reptile [31]

the answer is relative humidity

5 0
3 years ago
Read 2 more answers
A lake has very deep water at the bottom, in the benthic zone. why is it more difficult for plants to live in the benthic zone o
creativ13 [48]

<span>This is because benthic zone are too dark to support photosynthesis. Due to their depths, sunlight is unable to penetrate the above lying waters and reach the region. This way plants cannot carry out photosynthesis hence cannot grow. This is why only </span>decomposers, detritus feeders can be found in the benthic zone.

4 0
3 years ago
Other questions:
  • How does temperature help with a surface report?
    8·1 answer
  • All cells reaction that take place in the body is called ?
    15·1 answer
  • What are 3 scientific questions about the role of DNA &amp; Chromosomes?
    5·1 answer
  • Are populations supposed to change or stay stable over time?​
    8·2 answers
  • Describe what will happen to the wave as it goes through the hole. what do we call this?​
    9·1 answer
  • A _______ is a change in the DNA sequence. mutation displacement
    5·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Which of the following pairs of terms is mismatched?
    5·1 answer
  • A large geographic region with consistent weather conditions and kinds of plants is called a _______
    8·2 answers
  • Science: Ecosystem Passage, Jan. 14, 2022 1. Read the passage about the ecosystems. 2. Answer the questions in complete sentence
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!