1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Usimov [2.4K]
4 years ago
12

Look at the following pictures. These pictures represent the stages of mitosis. Using the letter beneath each picture, put the l

etters in the correct order to represent the sequence of stages in mitosis. Separate each letter with a comma and space (example: E, D, C, B, A)
Biology
1 answer:
balu736 [363]4 years ago
3 0
So the question ask on to arrange the pictures base on the sequence of stage in mitosis and the best order is Letter E, C, A, B. I hope you are satisfied with my answer and feel free to ask for more if you have clarification and further questions. Have a nice day 
You might be interested in
Choose the CORRECT statement about enzymes below.
Papessa [141]

Answer:

Enzymes function best at specific pH and temperatures.

Explanation:

An enzyme can be defined as a biological catalyst that typically lowers the activation energy of a biological reaction. When the activation energy of a reaction is low, the rate of the reaction would be faster. Therefore, an enzyme speeds or catalyzes the rate of a reaction by lowering its activation energy.

Also, if the conditions are not optimal for an enzyme, it limits the ability of an enzyme to bind or be joined with its substrates.

Hence, the correct statement about enzymes is that enzymes function best at specific pH and temperatures. An increase in temperature increases or speeds up the rate of a reaction while low temperature limits or reduces the rate of a reaction. The optimal temperature for enzymes in the human body is around 37 degrees celsius.

8 0
3 years ago
1. Compare and contrast ATP and NADH.
Leokris [45]

Answer:

Glycolysis produces 4 ATP molecules, giving it a net gain of 2 ATP molecules. The four high energy electrons that are removed by glycolysis are picked by an electron carrier called NAD. NAD becomes NADH.As it spins it grabs an ADP molecule and attaches a phosphate, forming high energy ATP.

Explanation:

Both NADPH and ATP are phosphorylated compounds, both are very important catabolic as well as anabolic processes. To explain the difference, their respective functions/roles in biochemical processes should be described along with relevant chemical properties.

ATP (Adenosine triphospahte) is called an energy rich molecule because of the large negative free energy of its hydrolysis (And has nothing to do with high bond energy).

30.5 kilo Joules or 7.3 kilo calorie energy is liberated after hydrolysis of one ATP molecule to form ADP (Adenosine diphosphate) and phosphate.The reaction is almost irreversible

5 0
3 years ago
The second drawing shows a situation when a larger force is applied to the box than the force of friction. The result is that th
Hunter-Best [27]

Answer:

B

Explanation:

because they are moving at the same direction

8 0
3 years ago
Somatic mosquito cells have 6 chromosomes. How many chromosomes do gametes have?
faltersainse [42]
<span>Somatic mosquito cells have 6 chromosomes. Its gamete has 3 chromosomes. 
</span>
Mosquitoes have 6 number of chromosome but when mosquitoes<span> make sperm or egg </span>cells<span>, meiosis reduces the </span>chromosome<span> number to 3.
</span>
*the chromosome number in somatic body cells of a mosquito --- 6.
<span>the haploid (n) number is 3.
the diploid (2n) number is 6.</span>
5 0
3 years ago
Which type of unconformity occurs when sedimentary rock overlies igneous rock?
Sergio [31]

Answer:

nonconformity

Explanation:

There are multiple types of unconformity that occur in nature, all of which are base on the relative position of the types of rocks. The nonconformity is one of the unconformities. This type of unconformity occurs when sedimentary rock overlies igneous or metamorphic rocks that existed there before the sedimentary rocks covered them. The nonconformity can be seen in lots of places around the world, but it is most common on places where there are water bodies like lakes, seas, oceans, ponds, marshes, or on places where there were water bodies of this type in the past.

3 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • In algae and plants, photosynthesis happens in the
    5·1 answer
  • mary’s friend observes the investigation and claims that block b has more more mass. if there was no errors in this investigatio
    13·1 answer
  • Gaucher disease type 1 (GD1 ) is a recessive genetic disease that affects 1 in 900 individuals in a particular population. GD1 i
    11·1 answer
  • HELP AGAIN PLEASEEEEEEEEEEEEEEEEEEEEEEE
    8·1 answer
  • Explain which cells tissues or organs should be modified to lead to successful photosynthesis in animals or human Discuss how th
    8·1 answer
  • Which group is more likely to survive significant environmental change, one like black-footed ferrets with almost no variation o
    7·1 answer
  • 3. Which statement concerning an ecosystem is correct?
    10·1 answer
  • Describe the relation between the complexity of an animal
    5·1 answer
  • list of the following levels of biological organization from smallest to largest and give an example of each
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!